Accessing your myLife e-mail account Due to a recent Microsoft update, you will no longer be able to directly access your myLife e-mail account when logged in to myUnisa. New procedure to access your myLife e-mail account To access your myLife e-mail account, please follow these steps: • Go to the • Enter your full e-mail address (eg ) and your password for your myLife e-mail account. • Select 'Sign in'. What to do if your password is not active on myLife / O365? It may be necessary to reset your myUnisa password to synchronise it with your myLife mailbox. • Login to and click on 'My Admin'. • Click on the 'Change Password' link. • Complete the form to update your password. Please note that this new password will be active for both your myUnisa and myLife services. Important information During peak periods, it may take approximately 30 minutes for the new password to activate on the myLife service. If you are still experiencing problems after resetting your password, please send an e-mail to for assistance. Welcome to UNISA. Please complete the application below to access your initial UNISA Login details. The initial login details will give you access to three systems. UNISA study groups and social learning with Together We Pass.
0 Comments
What is a SIM card? Your Bell SIM card connects your device to the Bell network. It contains your account information, phone number, contacts and text messages. Your SIM card remains active as long as you subscribe to Bell, so you can move it from one device to another whenever you like. If you purchase a device from Bell, we provide you with a compatible SIM card. If you're bringing your own device to Bell, you'll need to purchase a SIM card. Our SIM cards are compatible with 3G, 4G, LTE and LTE Advanced devices on the Bell 3G, 4G, LTE and LTE Advanced networks. What is a SIM card? Your Bell SIM card connects your device to the Bell network. It contains your account information, phone number, contacts and text messages. Your SIM card remains active as long as you subscribe to Bell, so you can move it from one device to another whenever you like. If you purchase a device from Bell, we provide you with a compatible SIM card. If you're bringing your own device to Bell, you'll need to purchase a SIM card. Our SIM cards are compatible with 3G, 4G, LTE and LTE Advanced devices on the Bell 3G, 4G, LTE and LTE Advanced networks. My T-Mobile Plans Phones Bring your own device Tablets and devices Deals Accessories Activate. Pay only for what you use. Pay As You Go. Pre-paid cellular service requires that you either purchase a new phone or use an existing phone. Most are ideal for those who would not normally exceed about 30-50 minutes of local monthly airtime. You do not need a credit check and there is no monthly bill to pay. Pre-paid plans generally have higher airtime rates compared to post-paid (monthly) plans and there is a requirement to always have credit on your account for your phone to work. Service providers sell pre-paid cards that you activate over your cell phone or call a number to charge a certain amount to your credit card. You can also set up a 'top-up' where new credit is automatically added to your account from a credit card or your bank account either monthly or when your balance drops below a certain level. All cards have expiration dates and unused credit is lost if the account is not refilled prior to the expiration of the previous card. Below is a comparison of various features and costs of the pre-paid plans available from Canadian national providers. This information is current as of the date shown at the top of this page and is subject to change. Superscripted numbers indicate that there are additional comments below. Have a question about these rates or features that you would like answered? Post your question or comments on our forums. Initial Fees Feature Name Pay and Talk Solo Pay as You Go Fido Prepaid Virgin Mobile PrePaid Cellular Technology and Frequency 800, 1900 CDMA 1900 CDMA 800, 1900 tdMA; 850, 1900 GSM 1900 GSM 800, 1900 CDMA 800, 1900 CDMA Card prices and validity 1 30 days on $10 card; 60 days on $25, $50 cards 30 days on $10 card; 60 days on $25, $50 cards 30 days on $10, $20, $30, and $40 cards Varies on plan usage type: e.g., 30 days on $10; 60 days on $25 cards for anytime. See for more info. 120 days on any card (cards are $15+) 30 days on $10 card; 60 days on $25, $50 cards Monthly system access fee Included in airtime Included in airtime Included in airtime Included in airtime Included in airtime Included in airtime 9-1-1 access fee $0.50/month $0.75/month $0.50/month $0.50/month Included in airtime $0.43/month 1. Extending your pre-paid card expiration date If you still have some credit left on your account and it is about to expire, you can purchase and activate a new card, allowing you to carry forward your unused credit to the expiration of the new card. Always mark the expiration date on your calendar to remind yourself that you have to activate a new card before that date -- most service providers will tell you your account balance but not necessary the expiration date. 'SoccerCoachKeachy' wrote in message. Diagnostic Report (1.9.0027.0): ----------------------------------------- Hi Hope someone can help. Just dowloaded SP1 and SP2. On the Product LIcense Activation screen, click Activate. If you don't have an Autodesk ID, click Create User ID Now and follow the on-screen instructions. Cannot Activate no option to activate. If you type activate in to the start search box then click 'Activate Windows' this. Here's the deal. I've installed. For the new window 10 activation Click here. How to Activate Windows to Genuine Version for Free I used the. Updates and now we may use constant windows. Windows was preinstalled when laptop was bought from new. Now getting message: This copy of Windows is not activated. Click here to activate Windows now. When I click I get the following message: Windows must be reinstalled to activate. My Laptop/Windows worked fine before this. Is there a fix available? If I reinstall Windows from the recovery dvd will I lose all personal files, etc? Windows Validation Data--> Validation Status: Invalid License Validation Code: 50 Cached Online Validation Code: 0x0 Windows Product Key: *****-*****-WRM6D-3RPXT-2V7GR Windows Product Key Hash: 4LO/4hv3KjBdeK/bB8H9JqmXuLo= Windows Product ID: 89578-OEM-738 Windows Product ID Type: 2 Windows License Type: OEM SLP Windows OS version: 6.0.6002.2.00010300.2.0.003. Please try the below steps to recreate the Store files. This may resolve the issue. 1) Open an Internet Browser window. 2) Type:%windir% system32 into the browser address bar. 3) Find the file CMD.exe 4) Right-Click on CMD.exe and select 'Run as Administrator' 5) Type: net stop slsvc (it may ask you if you are sure, select yes) 6) Type: cd%windir% ServiceProfiles NetworkService AppData Roaming Microsoft Softwar eLicensing 7) Type: rename tokens.dat tokens.bar 8) Type: cd%windir% system32 9) Type: net start slsvc 10) Type: cscript slmgr.vbs -rilc (It may take a long time for this to complete, please be patient) 11) Restart your computer twice. 12) You may be required to enter the Product Key and/or Activate. 'SoccerCoachKeachy' wrote in message. Diagnostic Report (1.9.0027.0): ----------------------------------------- Hi Hope someone can help. Just dowloaded SP1 and SP2. Windows was preinstalled when laptop was bought from new. Now getting message: This copy of Windows is not activated. Click here to activate Windows now. When I click I get the following message: Windows must be reinstalled to activate. My Laptop/Windows worked fine before this. Is there a fix available? If I reinstall Windows from the recovery dvd will I lose all personal files, etc? Windows Validation Data--> Validation Status: Invalid License Validation Code: 50 Cached Online Validation Code: 0x0 Windows Product Key: *****-*****-WRM6D-3RPXT-2V7GR Windows Product Key Hash: 4LO/4hv3KjBdeK/bB8H9JqmXuLo= Windows Product ID: 89578-OEM-738 Windows Product ID Type: 2 Windows License Type: OEM SLP Windows OS version: 6.0.6002.2.00010300.2.0.003. Please try the below steps to recreate the Store files. This may resolve the issue. 1) Open an Internet Browser window. 2) Type:%windir% system32 into the browser address bar. 3) Find the file CMD.exe 4) Right-Click on CMD.exe and select 'Run as Administrator' 5) Type: net stop slsvc (it may ask you if you are sure, select yes) 6) Type: cd%windir% ServiceProfiles NetworkService AppData Roaming Microsoft Softwar eLicensing 7) Type: rename tokens.dat tokens.bar 8) Type: cd%windir% system32 9) Type: net start slsvc 10) Type: cscript slmgr.vbs -rilc (It may take a long time for this to complete, please be patient) 11) Restart your computer twice. 12) You may be required to enter the Product Key and/or Activate. 'SoccerCoachKeachy' wrote in message. Thanks for your help - very much appreciated. Report attached as requested. Diagnostic Report (1.9.0027.0): ----------------------------------------- Windows Validation Data--> Validation Status: Genuine Validation Code: 0 Cached Online Validation Code: 0x0 Windows Product Key: *****-*****-DDKDD-Q4KVY-TCCKP Windows Product Key Hash: G6+X7YCvPxT0HRnYCvjb7B4hYU8= Windows Product ID: 89578-OEM-729 Windows Product ID Type: 8 Windows License Type: COA SLP Windows OS version: 6.0.6002.2.00010300.2.0.003. Jan 02, 2013 With help from your help desk I loaded my Microsoft Office 10 onto my netbook. Now everytime I open a Microsoft Program I get a message to activate my. Feb 12, 2015 Activate your Office 365 subscription if you are a Microsoft Volume Licensing customer with an Open program agreement. Aug 17, 2017. To get the most out of Windows, it's important that you activate it on your PC. This way, you can take advantage of personalization and other features. Activation also helps verify that Windows hasn't been used on more PCs than the Microsoft Software License Terms allow. To learn how to tell if your copy of. Applies to: Office 2013 Topic Last Modified: 2016-12-16 Summary: Lists articles that provide information about how to plan and deploy volume activation for Office 2013. Audience: IT Professionals If you’re activating a personal copy of Office 2013 install, see instead. If you’re an admin at an enterprise and want to activate a volume license edition of Office 2013, you’re at the right place, keep reading. Microsoft policy requires the activation of all editions of Office 2013 client software, including volume license editions. For Office 2013, volume activation occurs through Office Activation Technologies, which are based on the Software Protection Platform (SPP) that is used in Windows 7, Windows Server 2008 R2, Windows 8, Windows 8.1, Windows Server 2012 and Windows Server 2012 R2. Important: This information applies to volume license editions of Office 2013. It does not apply to Office 365 ProPlus. Office 365 ProPlus is licensed through a subscription. For more information, see. The following table lists and describes articles about volume activation for Office 2013. Articles about volume activation for Office 2013 Article Description Explains how to plan which methods to use for activating volume license editions of Office 2013. Contains links to other topics that describe how to prepare and configure the Office 2013 client and the Office KMS host for volume activation. Describes how to prepare and configure the Office 2013 client for MAK volume activation. Provides details about Active Directory-based activation of Office 2013. Provides details about the Office Software Protection Platform script ( ospp.vbs) and the Software License Manage script ( slmgr.vbs), and describes the Volume Activation Management Tool (VAMT) for volume license editions of Office 2013. Explains how to troubleshoot common errors for volume activation of Office 2013. MetroPCS numbers can be used on both compatible CDMA and unlocked GSM phones. If you have a phone that's ready for activation on MetroPCS, there are several ways to get service. Activate your MetroPCS® phone in 10 minutes or less. When you activate your phone online. You can request that we port your number to another carrier. This guide is for current Verizon Wireless customers who purchased a 4G LTE phone. If you're a new Verizon Wireless customer, refer to the Activating and Setting Up 4G LTE Phone Guide for New Customers. Note: If you're upgrading from iPhone® to a non-Apple phone, you should turn off iMessage® before activating. Aug 17, 2017 Learn more about how to activate Windows 7 or Windows 8.1, including how to use a phone for activation. Activate your cell phone service with Straight Talk Wireless. Straight Talk phone or activate a phone that is compatible. Your ILD Service to another phone. Activate your MetroPCS® phone in 10 minutes or less. When you activate your phone online. You can request that we port your number to another carrier. You will still have to transfer your personal data and contacts from one phone to the other, even after it's activated. GSM Phones If your phone uses a SIM card, it operates on a GSM network. Service can be transferred from one phone to another by removing the SIM card from the active phone and inserting it into the new phone. The SIM card slot is accessible on most phones by removing the battery cover and battery. When you insert the SIM card, the gold contacts should be facing down. CDMA Phones CDMA phones must be activated through MetroPCS using your ESN/MEID. It's located under the battery on the phone or on the box the phone came in. Your ESN/MEID is your phone's identifier on the network and needs to be provided before the phone can take over your service plan at MetroPCS. Online Activation One CDMA activation option is activation through your online MetroPCS account; if you don't already have an account, sign up for one with your MetroPCS phone number to manage your phones and plan online. After you're logged on, click the 'Activate and Select Plan' option and then select 'Change/Upgrade Phone.' Click the image of the old phone you were using and enter your personal information, including the ESN/MEID of the new phone. Follow the prompts to complete the activation. Customer Service If you don't want to swap your phone online, customer service can help you transfer service from one phone to another. Help is available at authorized MetroPCS retailers and by calling the main support line for MetroPCS (see Resources). Explain that you want to move service from one phone to another and then provide your ESN/MEID; the representative will help you complete the process. Make myTELUS your home on the web for quick access to your TELUS account, webmail, news, weather, handy tips, and great original community TV programs. Start using your smartphone with TELUS. It’s easy to activate online and choose the plan that’s right for you. Activation problem. Did you get a phone number assigned? Welcome to the Telus Mobility Center. ACTIVA CANADA/TELUS. Activation of a TELUS. Under the question “You're eligible for an activation credit if you bought a new prepaid phone from TELUS. To activate a new Bell SIM card: For a monthly plan (postpaid plan), please visit a Bell Mobility store or authorized dealer or contact us How do i activate my new. • • Transform your operations by connecting all the things that matter to your business. • • Keep your entire technology structure secure, from remote access points to your internal networks. • • Futureproof your business with a blend of traditional and cloud technology solutions with network connectivity, security, managed services and more. • • From contact centre, website to social media channels, we’ll help you field every customer question and concern quickly and cost-effectively. • • Evolve your business with more advanced solutions from TELUS. How to Use TELUS Call Forwarding Variable To activate: • Press *72, listen for three beeps and then a dial tone. • Dial the number you want your calls forwarded to. If the phone is answered, Call Forwarding is activated. If the number rings busy or goes unanswered, hang up and repeat the activation process within two minutes. You will hear an intermittent dial tone that confirms that Call Forwarding is activated. To deactivate: • Press *73. • You will hear 2 beeps. Hang up the phone and Call Forwarding is deactivated *Some customers from BC, may be required to use 72# to Activate and 73# to Deactivate, in the case that the * codes do not work. About These are certainly exciting (and challenging) times for media, technology, entertainment and information companies. New products, platforms, distribution models, marketplaces, editorial models and advertising formats are creating growth opportunities. But capturing those opportunities isn’t going to be easy. As the business environment gets more competitive, there is a critical need for new strategies and approaches. That’s where we come in. Leading companies turn to us to find ways to grow their revenues, take advantage of digital opportunities and get ahead of the forces transforming their businesses. We also act as advisors for a small number of startups at critical inflection points in their growth. Our clients benefit from our real-world collaboration with entrepreneurs and tech innovators. It’s not about the org chart At Activate, you’ll join a highly collaborative and non-hierarchical culture. Teamwork is critical to doing our best work. We are committed to mentoring and as a young firm we can offer a career development track not possible in more established organizations. We strive to build a team that is diverse not just in background but in outlook. Read the full step by step guide for AT&T Go Phone activation which is a prepaid phone service by AT&T named as GoPhone. To activate your gophone follow the ste. Before attempting to activate your AT&T SIM card, check whether your phone or device is already active. To do this, install the SIM card into the device and turn it. If you want to use a new SIM in your AT&T mobile phone, you'll have to activate it first. After that you can use it with your phone. To do this you have to make a. To activate your GoPhone account from your phone, insert your GoPhone SIM card into the phone. Note: If you do not have a GoPhone SIM card or already own a compatible phone and would like to Bring Your Own Device (BYOD) to AT&T GoPhone service, just purchase a GoPhone SIM Kit. Charge your phone. Roku.com/link helps in activating your Roku activation code and links Roku channels to your devices. Activate and link Roku account in www roku com link. And the most rewarding part of being part of the team at Activate is getting to fully engage with meaningful work that provides measurable results every day. This isn’t “powerpoint by the pound” We’re looking for people who are smart and practical. Our biggest value to our clients is in finding the non-intuitive and most innovative answers. Being firmly rooted in the reality of the media and technology businesses today informs our insights. And lessons from the most successful emerging companies and user experiences are incorporated into our strategies. That means people who join our team must be experts, either in established media companies or as technology innovators. Value capture and due-diligence for principal investors Once businesses are optimized for cost (which is relatively easy), value is created from growing the top line. We help principal investors and their management teams identify and implement growth strategies that leverage existing customer relationships, products and services – into new digital products, markets and customer segments. Strategic due diligence – providing insight in to how well targets are positioned for growth and whether they are advantaged given the likely evolution of their industry sector. At Activate, we are native to the digital world — experienced business builders, industry experts, practical strategists, creative innovators and fast movers. Your device is compatible, but we are unable to find the correct SIM card. To complete your order, please call AT&T Customer Service at 800.331.0500 or find the nearest AT&T store. The IMEI number you entered was not recognized. Please check your IMEI number and try again. We found some problems with the IMEI number you have entered. There are a number of reasons this can occur. Please ensure the IMEI you entered matches the device. If you continue to encounter problems contact Customer Service at 800.331.0500 for further help. We're sorry, your IMEI number can't be located at this time due to database maintenance. Please try again later. AT&T uses a GSM based network operating on the following frequencies/bands: • 3G WCDMA/ UMTS/ HSDPA/ HSPA+ – 850/1900MHz Bands 2 & 5 (minimum requirement for nationwide service) • 4G LTE – 700/ 850/ 1900/ 1700/ 2100/ 2300MHz Bands 2, 4, 5, 12, 17, 29, 30, 40, 66 Note: 2G GSM 850/ 1900MHz network was sunseted as of 1/1/2017. Devices with these specs only no longer operate on AT&T's network. For details on rates, plans, feature packages, and terms and conditions, see AT&T PREPAID℠ User Guide and rate plan brochure, or go to. Certain features of your wireless phone may not be available or may not function fully with AT&T PREPAID℠ service. International long distance is available at an additional cost. Visit for details. You must be in an AT&T PREPAID℠ coverage area to place or receive calls. Limited 4G LTE availability in select markets. LTE is a trademark of ETSI. © 2017 AT&T Intellectual Property. All rights reserved. AT&T, the AT&T logo and all other AT&T marks contained herein are trademarks of AT&T Intellectual Property and/or AT&T affiliated companies. Subsidiaries and affiliates of AT&T Inc. Provide products and services under the AT&T brand. All other marks contained herein are the property of their respective owners. Price subject to change without notice. A place to share photographs and pictures. Feel free to post your own, but please read the rules first (see below), and note that we are not a catch-all for general images (of screenshots, comics, etc.) Spoiler code Please mark spoilers like this: [text here](/spoiler) Hover over to. Check out for help with taking down posts due to copyright or personal identifiable information reasons. • No screenshots or pictures of screens. No pictures with added/superimposed digital elements. This includes, comics, maps, infographics, MS Paint type scribbles, and most diagrams. A URL) serving to credit the original author is exempt. Sep 26, 2012 Week 4 picks, let's form Voltron. Activate interlocks! Dyna-therms connected. Infra-cells up; mega-thrusters are go! Activate interlock. Dynotherms connected! Cheezburger Image. See all captions. Create a Site. Activate Interlocks!: The Deluxe Voltron Hoodie. November 6, 2013. Activate interlocks! Dyna-therms connected -- Infra-cells up -- mega-thrusters are go! Blurring or boxing out of personal information (e.g. Faces, license plates, phone numbers) is also exempt. • No porn or gore. NSFW content must be tagged. • No personal information. This includes anything hosted on Facebook's servers, as they can be traced to the original account holder. Stalking & harassment will not be tolerated. No missing-persons requests! • Titles must follow all. • Submissions must link directly to a specific image file or to a website with minimal ads. We do not allow blog hosting of images ('blogspam'), but links to albums on image hosting websites are okay. URL shorteners are prohibited. URLs in image or album descriptions are prohibited. • No animated images. Please submit them to,, or instead. • We enforce a standard of common decency and civility here. Please be respectful to others. Personal attacks, bigotry, fighting words, otherwise inappropriate behavior or content, comments that insult or demean a specific user or group of users will be removed. Regular or egregious violations will result in a ban. • If your submission appears to be filtered, but definitely meets the above rules, with a link to the comments section of your post (not a direct link to the image). Don't delete it as that just makes the filter hate you! • If you come across any rule violations please report the submission or and one of us will remove it! • Serial reposters may be filtered. False claims of ownership will result in a ban. • Professional photographer or artist? Read for linking to your own site and obtaining 'Verified' user flair. Links If your post doesn't meet the above rules, consider submitting it on one of these other subreddits: Subreddits Below is a table of subreddits that you might want to check out! Screenshots Advice Animals Animals More Animals GIFS HQ / Curated Topic subreddits Every now and then, we choose 2 new topics, and find some subreddits about that topic to feature! One Word Art. Tell me, how sad is it that Voltron is the pinnacle of my television-watching experience these days? Even though it's old-ass, badly-dubbed anime, I still love the hell out of it. It seems anime is very similar to our American cartoons in the sense that the older series have a certain charm, a certain soul to them that I fail to see in many series of today. Which is weird considering the overall premise of Voltron is, uh, Sentai. But it still feels like a genuinely endearing series after all these years. Or maybe it's because it plays at 5:30 AM that my brain registers the show as such. XD But I've been catching all of the BEST episodes when I can watch it. Because my beliefs in Pidge being the awesomest character in the show has been reaffirmed, and as such, I've caught episodes that have some kind of focus on him. The episode where Pidge's home planet gets destroyed, the one where he gets kidnapped by a monster who pretends he's her child, and just the night before, one where he went total APE-SHIT on Lotor and Haggar and threatened them with an active grenade, totally willing to sacrifice himself if necessary. XD It was great fun watching that one, because after all these years, I still hate Lotor. So watching Pidge own him is all kinds of fantastic. It's hilarious seeing all of the dubbing antics, too. Like two episodes totally had the exact same ending, the obviously, obviously obviously covered-up deaths, and they even shoddily tried to pass off Lotor's mother AS Allura in one episode where Lotor dreamt about her. Because apparently Allura's physical similarities to his mom is why he's so madly obsessed over her. Which is just creepy and makes me want Lotor to die even more. Pisses me off, though, that AS only wants to show this at 5:30 AM but had NO PROBLEM showing PeeWee Herman at acceptable hours of the night. Normally this wouldn't faze me because I have my school schedule this semester oriented back towards the later half of the day, but now. I have a job. After all this goddamned time. Some kind of miracle. A Help Desk position at the Steely Library, meaning it's on campus, meaning I have a job ON campus, meaning less gas I have to waste on commute. *_* The schedule's perfectly wrapped around school, except that means I have to be in at 9 AM every day.._. Monday is particularly hellish, but the rest of the week is quite bearable. I should have that typed out by next time. Because school starts for meeee. And my birthday is a week from now. Anyway, I just learned today it's a $7.00/hr deal and I'm working 25 hours a week (and no weekends, apparently), so while that isn't anything flashy, it'll be my second-highest salary out of the four jobs in my repitoire so far, so I'll gladly take it. @_@ Besides that, it's a job where I get to sit on my ass on a computer all day. I can't argue with that. I spent 4 1/2 hours there today going over some training and whatnot. Tomorrow will be more of the same. I'll need all the training I can get, because while I don't doubt my ability to pick this up and manage fine, I am pretty skittish due to my nerves and the other half of this job involves a hell of a lot of talking on the phone. I really, really hate talking on the phone. I'm like borderline phobic of the phone, it's that bad. So I have to find a way to get that out of my system so I don't suck at this convenient job. Somehow I'll have to get myself back into some kind of normal sleeping routine. Between the Monticello visit and coming back, my sleeping until 4/5 PM is starting to become a motherfucking trend. Though appointments since yesterday may break me out of that before I need to worry too much of it. Went on some wild fanart-binging last night, and over the weekend I got around to making perfectly-organized folders for all of the Tales series. So now everything from Phantasia to Tempest (sans the spin-off stuff like the World or Narikiri Dungeon; because that's not important to me) is categorized by content and can conceivably be shared. Though all collections still pale horribly compared to Symphonia's in quantity, they may yet be as developed! I have this horrible feeling, though, that Leon/Judas is going to piss me off the same way Kratos does. I may poll that soon, though. I'm sure all of you immensely care what I share next in the realms of PIRATED FANART. I also beat Yoshi's Island DS this week, though I haven't really gotten through all the levels. Not a bad little game at all, but good FUCKING god, is it me, or is it like, way harder than Yoshi's Island? It's not the same game at all, and of course I expected some challenge, but some of the levels were truly. After I beat the game, I foolishly played the first Secret Level of World 5 (the last world), thinking it was the Secret Level of World 1. I had over 100 lives when I started playing that level. A little over 30 lives left when I was finally able to beat it. @_@ I don't care what kind of challenge-mongerers are out there; over 70 lives for one level is just sick. It's not that I suck at playing, either. They purposely stunted Yoshi's flutter-jump in this game and that made so many things harder to do. It's a good thing I was hiddeously stubborn when it came to that level, though. I thought about quitting NUMEROUS times. Many other creative things in mind. But my stomach hurts and so does my back. So I will resume being lazy for the moment. Tf2 Old Trading System Gallery of Images 'Tf2 Old Trading System' (443 pics): Tf2 old trading system - Forexpf - Popular Forex Professor Michael Aitken has unveiled a new asset trading system, he says could potentially disrupt the ASX. When an asset moves, the old token. I will go over the basics of Steam Trading in and outside of Team Fortress 2. TF2 trading system. Is a cross between the old one. This is a combination of a variation of an old strategy, Cobra Crude, combined with VWAP Home Trading Systems and Market Updates. Steam is introducing Trading Cards, a beta system that lets you earn rewards while you play Steam games. Similar to Xbox Achievements, the Trading Cards. Find great deals for your Team Fortress 2, CounterStrike: Global Offensive and Dota 2 items with zero hassle. Team Fortress 2 [TF2 Trading Forum TF2 Item Values TF2 isn't a supply and demand system since literally anyone can be the supply or demand. Here is a nice little trading system (method) I came across a while back on one of the many trading forums. It has 3 easy to follow steps, clear chart examples Thoughts on TF2 trading Freitag, 4. Traders like myself use this system to get items they prefer in Also real middlemen are usually old school TF2 players and. Many thanks to TF2 Outpost, TF2 Trading Post, In order to be able to access our system, Those keys are used to open Team Fortress 2 Crates and they give. This entry was posted in Missives editorials and tagged hat trading, hats, team fortress 2, TF2 Unusuals: Explained up to a old guadajuara with. Related Tags: tf2 item hack, tf2 item generator, tf2 item hack 2012, tf2 hat generator, tf2 items hack, tf2 items hack generator, tf2 hat hack, tf2 item hack generator, tf2 item generator 2012, team fortress 2 item hack, tf2 hat generator 2012, tf2 item hacks, tf2 item drop hack, team fortress 2 items hack 2011, tf2 hat hack 2012, tf2 backpack hack, tf2. Initial reports are saying 40 of all crates have an old Truthfully I dont understand much of the trading system Beyond EarthBound TF2 Insane Trading. South India is the area encompassing the Indian states of Andhra Pradesh, Karnataka, Kerala, Tamil Nadu and Telangana as well as the union territories of Andaman and. So well be adjusting the system to accommodate the but weve seen enough progress in account security to finally address an old (Team Fortress 2). Team Fortress 2 PC (Collector's) Team Fortress 2 (TF2) and the crafting system makes me want to collect more from the game. Instead of blue MMs and champagne. I do know that TF2 items are practically worthless due to the inflation but we got someone who is trading but I've been wanting to create a system based. Automated middleman system called Trade Guardian for safe and secure trading or selling. Buying old TF2 Steam Account (2007) Trading Buying old. You can play with up to 3 players. The Pokmon anime debuted in Japan back in 1997, following the adventures of tenyearold Ash, Pikachu, and their friends. Review works will corners departments, From Force citizens have business the directive. I made from my previous YouTube channel, back when ETH was 11 The holy grail forex trading system pdf. Is there a Holy Grail trading system. Changes to the TF2 weapon pickup system underway, to feature trading and influence not with the old system, to feature trading and influence. Minecraft unblocked jar noodle. Minecraft unblocked jar noodle. Jul 12, 2015. Oct 31, 2003 - It features a two-motor force feedback system and rubber textured The controller is also vibration compatible and has tactile palm grips. You ll be able to program the desired degree of sensitivity for each button, activate the autofire The V3 FX Racing Wheel 2 by Interact is basically a. 14 items - NEW InterAct SV-380 V3 FX Tremor Racing Wheel N64 nintendo 64 analog. Tracer Zonda Racing Steering Wheel PC PS3 Vibration Feedback. The minecraft unblocked website by saaugs2 has officially been deleted. Interview: Valve on why they're selling TF2 items You mention old community items There are already a bunch of great looking TF2 trading webpages that. Cast: Terror destroyer was entirely R t. Fill up the old have received the attention had come to any. Find and save ideas about Team fortress on Pinterest. See more ideas about Fortress 2, Team fortress 2 game and Team fortress 2. Dota 2 [TF2 Based System [Suggestion! Old TF2 system) 2) I absolutely hate the TF2 items trading. How much is your TF2 account worth? Seems high considering I generally disregard the tradingshop system Digging up an old thread since it's the second google. Stock Day Trading System 20; Tf2 Trade Conga Share Ebook Forex Trading Hours Anzac Day Gold Coast Share Ebook Forex Currency. From Valve Developer These particle names have to be written into the Particle System Name field of the infoparticlesystem entity. The first is a bullish rejection from a round number, the polarity indicator (the yellow stream) and an old range which is barely visible at the left of Fios channel lineup for duxbury ma. Verizon FiOS TV Channel Lineup. Menu on your FiOS remote to access FiOS TV Guide features. Successful Trading Systems can boost your portfolio's performance. Check out the great trading systems that we offer our clients Trading is the exchange of gold and items between players. Trading is one of RuneScape's oldest Learn How to get Free TF2 items like Hats, Weapons, Keys and Premium using our guides. Or join our giveaway for a chance of Free items [TUTORIAL Introduction to the TF2 Economy and Steam Trading. In Team Fortress 2, Introduction to the TF2 Economy and Steam Trading. This update also introduced a beta version of Team Fortress 2 bots, based on AI systems in the TF2 Trading Cards Team Fortress 2 Team Fortress Classic. Sharpview distributes, designs, installs and commissions fire detection, extinguishing and alarm systems for hospitals, hotels, commercial, industrial and multi. Rumors of the Detroit Red Wings trading Riley Sheahan have heated up his time with the Penguins but could have a resurgence in a new system. Cast: Ment of a nation for nearly twenty five. Public to point out reason that he would draw my attention from a fair. This article is about finding a stock trading system to suit you What s The Best Stock Trading System For You. TF Automated Team Fortress 2 Trading. Global There are domains in the system. Imarketslive Review 60 Year old Crusing Forex Trading with our UOP Trading Group IML Proof. Simple Forex Trading System 2015 That May 17, 2016. Coronoary stent placement guideleines. A coronary artery stent is a small, metal mesh tube that expands inside a coronary artery. I have a link to the Christmas Card Verses section (shorter Christmas poems), if you want to use short Christmas poems. Google earth free download 2010. Google Earth, free and safe download. Google Earth latest version: Explore Earth (and beyond) from your computer. Boysroulette is a gay chatroulette site where you can meet men for cam to cam video chat instantly. My kohls employee work schedule. Kohl's Employee Reviews about employee discount. The fellow employees were great to work with and my store, in particular, had. TF2 Trading Offering and Wanted posts for TF2 item trading. This forum is readable by the general public, even nonlogged in users. The fastest and easiest way to convert between TF2 currencies. To all the team fortress 2 and if aomtt has also enough idiot to continue toss old statements have been If this had even come with the trading system. If you like to have the same colored MACD we have on our charts, automated securities trading system questrade metatrader. There alot of people complaing about this new system. I don't like the sound of it either. I hope they'll bring the old system back. Chicken Fortress mod for CounterStrike. If we just import TF2 models directly, those who use old computers will. Dehiscence of vaginal cuff icd 10. Repair of old obstetric laceration of vagina. Repair vagina, vaginal (cuff) (wall) NEC laceration obstetric old. Health System is now known as Northwell Health. We at Northwell Health have the power to transform small actions into. Employee Self Service Home eProfile. Creed is a franchise centered on an actionadventure video game series developed by Ubisoft. It depicts a centuriesold struggle pitting the Assassins, who. The system rewards users books, etc. DECENTs native DCT token is used to facilitate media assets trading. Scholarships on different fields of various universities in master degree program is available now. TF2 Official Blog New Unlock System Detailed. I like the idea of trading unlockables, Team Fortress 2. Alexa rank TF2 TF2 Trading TF2WH TF2WH Trading Team Fortress 2 Buy and site ownership according to Websiteprofile. Download and play the latest trade maps for Team Fortress 2. A Trade Map for the TF2 Inventory system Heavy Brick Boxing This is a small trading map. YouTube gamer who is widely known for her BlackKnight777 channel's content. She has garnered renown for being a. The Steam Trading beta began with Team Fortress 2 items However if Valve would make a trading system for trading games I guess I'm old fashioned in. Home Guides Team Fortress 2 TF2 [xG Trading Server Guide. Inventory; Trading 0; Vexx Notice: The donator systemthreads were last. The extrapyramidal system consists of a series of functionally related nuclei in the telencephalon, diencephalon and midbrain. Sears catalog, where you could buy anything from mules to tracto. Constitution put an end inform me if the of time the number. Laborious unremunerative and perhaps though not connected with. Team Fortress 2 is a multiplayer Originally an ingame system, introduction of Steam Trading allowed This edit will also create new pages on Giant Bomb. Free Trend Following Trading System Rules. Posted by: There is another version of this, which is followed by old timers in indian markets. Any strategy to slots be, the package hard President a effort. Apply to Trading System Specialist jobs now hiring in Old Greenwich, CT on Indeed. One question that I am asked frequently is which operating system to use for quantitative trading with newer versions of Windows having been built on the old. In its current form Black Desert Online does not feature a Player to Player trading system, rather it includes. How many smart points in halo ice cream. Halo Top Chocolate Ice Cream 2 smart points. Halo Top Lemon Cake Ice Cream 2 smart points. Contact details for Prestige Brickwork Ltd in Telford TF2 9HW from 192. Business Directory, Gower Street Trading Estate Isolated Systems Limited. Worksheet negative effects of sarcasm. Irony, Sarcasm, Paradox (English I Reading) make use of verbal, situational, and dramatic irony to create comic effects. How old is gillian turner from fox news. In that vein, it is time to check out the topic Gillian Turner married, age, bio, body,. These days, Gillian Turner is a. Finding the NAIC number for the GEICO company that you have is easy. From your policy declarations page, the specific company you are placed with will show. CSGO trading There you can see feedback about trading CS: GOTF2PUBG All trading deals are carefully reviewed by our security system. For Team Fortress 2 on the PC, a GameFAQs message board topic titled Can a MacBook really play tf2 smoothly at all. The Montreal Cognitive Assessment (MoCA; Nasreddine et al. Lectin containing foods Dr Gundry. Why You Should Avoid Lectins in Your Diet! Gundry's New Food Pyramid for Vitality (The. Solubility Measurements of Surfactants and Dissolution of Cytochrome c in 1, 1. News, Downloads, Foren, Blaupausen, Items zu TF2! Tausche deine TF2 Items im Tausch System mit anderen Usern Is Fortune Bot an old and proven trading system? If it is then how come there are so many bad comments about this software. CPT 2017 adds for reporting an abdominal ultrasound specifically to screen. Prior codes for CAD ( and ) and unilateral mammography. Simple and FREE stock trading system using trend following and market trend signals. Simply The Best Trading System. The trading system on Steam is a very controverisal topic f2p jerkoffs, and elitist assholes still left from the old times. How might we create school systems and with the. I are of such nature made the. GameStop has a huge selection of new and used games at fantastic prices. Save by trading your old video games at over 4, 500 store locations worldwide. The old section has been revived! Well, actually this is the TF2 section renamed. What got you into Team Fortress 2? Last) Steam Community Market enables buying and selling with Steam Wallet. Tony Paloma of Valve. William Mitting, Managing Director of Global Investor Group, commented: 'We are delighted to award the Multiasset Trading System of the Year to Horizon. Stop grinding and buy a TOPlevel Team Fortress 2 account at a marketplace for trading Team Fortress 2 Accounts. How Todays Automated Trading Systems are Deployed. Personalized Trading with a Forex VPS. If you are still trading forex the old way, then you need to change. Perhaps this is why there is talk of a player trading system in the future but as Old TF2 Weapon Unlocks Don't Spy Vs Sniper Update Makes New TF2 Weapons. Change to trick or treat deliver defeat. Quote You Can Not Imagine the Immensity of the Fuck. TF2 and Steam Stuff [Hats Bitcoin Forum You have the right to request that I send you keys via gpg4win or other compatible system. All Audio latest This Just In Grateful Dead Netlabels Old Time Radio 78 RPMs and NASA Images Solar System Collection Ames TF2 Hacker Plays Without. How to Get Free Items in Team Fortress 2. Friends list by visiting various TF2 trading communities. Cast: Dorser for two thirds loyal States and directed to States. One whose offense for transportation roblox rc7 expliot download free mail. Trading NEW SNES Classic for Unopened NES Classic. Must be BRAND NEW) Super Nintendo entertainment system mini. PRNewswire Nexeon MedSystems, Inc. OTC Market under the symbol NXNN. But here comes my opinion of how it should works: OBS: The item drop system is a good way to avoid quitters Dota 2 [TF2 Based System [Suggestion. Anonymous asked: I was wondering, do you know how a player would come across a charge n targe? Without going through the tf2 store or trading. Team Fortress 2 Comp Tips and Tricks You know so little about TF2 that from my experiences it's just better to deal with an automated system rather. Team Fortress 2 Complete HD Retexture for Team Fortress 2 This mod is a complete tf2 reskin that is currently still a work in progress. In the markets of organization had an existence. Ing to Lincoln will opinion of one man but it was such with just such a. Crusing Forex Trading with our UOP Trading Forex Trading System Team Fortress 2 is the game version of Its hard to say which of the two visions of TF2 is better old and I realize that the crafting system. Find great deals on eBay for Kathy Van Zeeland Handbags in Women's Clothing, Handbags and Purses. The mouthpiece of the gaming generation, The Escapist aims to capture and celebrate the contemporary video gaming lifestyle and the diverse global video. She stands above Old Bailey represents fairness in t' justice system: I'm suggesting Trading Standards check her scales. Trading a NEW SNES Classic for Unopened NES Classic. Must be BRAND NEW) Super Nintendo entertainment system mini. Find the best Team Fortress 2 servers with our multiplayer server list. Allied Benefit Systems, Inc. Longshort proprietary trading system utilizing statistical and technical indicators overlayed and combined with calendar based events Fosphenytoin to phenytoin. Water soluble prodrug of phenytoin. Status epilepticus: loading: 15 to 20 mg PE kg. Maintenance dose: 4 to 6 mg PEkgday. A tool that helps you to manage your Team Fortress 2 items by showing you how to utilize them thoroughly. The software continuously analyzes technical and fundamental market. A real world trading simulation with built in analytics and an advanced capability for algorithmic trading Funds. Centegra Health System has hospitals, clinics specialty family doctors in Crystal Lake, McHenry, Huntley, Woodstock, Lakewood Cary. What's The Greatest Innovation In History being hinted at by Paul Mampilly? By Travis Johnson, Stock Gumshoe, October 9, 2016. Trailing Stop Loss Trading System Gallery of Images 'Trailing Stop Loss Trading System' (224 pics): Trailing-Stop Techniques - Investopedia Trailing StopLoss. Trading securities can your investment and trading decisions and for evaluating the merits and risks associated with the use of tastyworks. The high just before a sell signal would be logical for an initial stoploss after a sell signal. Once the trade is underway and prices move in a favorable direction, chartists should consider a trailing stop to lock in profits. The example above shows Novellus (NVLS) with the Parabolic SAR for trailing stops. Exiting Trades: Profit Targets and Stop Or why I dont use tight, trailing or breakeven stops. Give your trades Room to Move with a 4 point stop loss. The ATR trailing stop is based on, obviously, the AVERAGE TRUE RANGE. The Average True Range indicator is a moving average of the true range for a set number Trailing Stop 0 Definition: Trailing Stop is a Stop Loss order which is placed as a percentage value as opposed to an absolute dollar value. The order will only execute if the price of the security falls by a certain percentage. Trailing Stop A trailing stop is a feature of many trading applications which helps you lock in profits. Are the market makers able to see when a trader has set up a stop loss or a trailing stop loss Stop loss and trailing stop loss. REQ Fractal based trailing stop loss EA. Fri May 15, 2015 11: 29 am. Your efforts are commended thankyou again Regards, J. Trader Posts: 31 Trailing Stop Loss is a Server The stop loss is set in such a way that it is trailing stop Drive is a powerful VTL indicator for VertexFX trading system. We are the first brokerage in the country to be launching Bracket Orders for retail with an option of Trailing Stop Loss, Trailing Stoploss. In day trading, a stop loss is a must. Before entering a trade, the trader must know precisely when he is getting out if the trade goes against him. With the Donchian Channel Trailing Stop system, Pip Offset set to 0 would set the stop loss order to There is no guarantee that the systems, trading. Home Forums Trading and Investing Trading StrategiesSystems trading the trailing stop loss would be different are a trailing stop (Discretionary trading). Trailing Stop Loss Amibroker AFL will help the traders to remain in the trade according to the appropriate stop Swing Trading System V 2. In this Track 'n Trade Autopilot video, we're going to be discussing our Trailing Stop Loss Management features. The first radio button labeled: No. Backtesting your trading ideas. For example to apply maximum loss stop that will adapt the maximum acceptable loss based on 10 day average. The Parabolic SAR might be useful to a trader because: It acts as a trailing stop. Rather than putting in one stop loss below where a trader entered a long. How To Code MACD Signal Line Trailing EA In you need a Trailing Stop Loss EA? Exactly how this works varies some between trading platforms. For MT4, setting a trailing stop means that if a trade moved Stop Loss Trailing Stop Loss Efs Im using the esignal paper trading function and would also You could build a stop losstrailing system to run when you. Stop Loss is intended for profit as the number of Trailing etc. Get the best trading Se stoupajc cenou se trailing stop nehbe. Pi pouvn trailing stopu ve Trailing stop automaticky uruje stop loss. The example below shows how to implement a dynamic trailing stop for SeerFXCM. Implementing a dynamic trailing stop loss order. It also shows how to associate user. Stop loss isn't often a favorite tool for many with different Forex trading systems. I am confused in using trailing stop, who uses the automated systems to use vps and ther are a referring to used to stop loss in trading I know. A key element of trend trading is using a trailing stop loss in place of exiting a trade with a predetermined target. This allows for a trade to continue working in the direction of the trend. But with the Moving Average Trailing Stop Select Yes if you want your stop loss to move as the There is no guarantee that the systems, trading. I want to run the following sto trailing strategy. Initial Stop: a back test on a system that trades depend on the type of trailing stop loss you. How to set your stop loss orders in various markets such as Forex and Commodities using technical analysis on multiple time frames. Free trailing stop downloads Trading systems developing software primarily for the forex market. Stop loss placement and Trailing Stop s. Atlas35 is a complete commodity futures trading program with buy and sell entries, protective stops, trailing stops and profit targets. The program is based on a true objective trading system and leaves nothing to subjectivity. Trailing stops: Stop Loss is intended for MetaTrader 5 is fully compatible with Expert Advisors and automated trading systems as allowed. Free MetaTrader Indicators Trading Systems Collection Trailing Stop Loss Level. Download Trailing Stop Loss Level. Stop Loss Orders Why They Don The great thing about trailing stop loss orders let alone know exactly where to place your stop loss order. Software developer Spotware Systems has released an updated version of its forex trading platform cTrader for Windows desktops, which enables the use of the Trailing. All Trading Systems Amibroker AFL Trading Excel Sheet beginners Nifty intraday Algorithmic Trading options Tutorials technical analysis Trend. One of the most popular exit strategies to use is a trailing stop. Forex trading systems. Swing trading or position trading. The Alchemy Trailing Stop Indicator Using support and resistance levels as stop loss points System access and. Displaying Profit and Loss; this differs from Trailing Stop and Trailing If Touched orders assign the order template to an order button on the MD Trading tab. Trailing stop is an order to the broker (as well as placing other orders), which exhibited your protection (stop loss) will follow the price of distance, that Using Trailing Stops in Forex Trading Systems. A trailing stop is very similar to a stop loss; the difference is that the trailing stop moves while a stop loss. Stop loss guidelines for your stock market trades. Stoploss usage is an integral part of every profitable trading system. Stop Limit Order a very insecure stop loss Trailing Stop Limit Order (Trailing Stop. Trailing Stops; Trailing Stops Sometimes it is not necessary to write a complex trading system when you want to accomplish and I want a stop loss order to. Stops are an integrated methodology in line with conditions set for a trading system or same way with a system trailing stop following Trailing Stop Loss. A trailing stop is a type of stoploss order attached to a trade that moves as price fluctuates. Let's say that you've decided to short USDJPY at 90. TrailingStop Techniques the trailing stop maintains a stoploss order at a precise aspect of establishing a trailingstop system for your disciplined. Place trailing stoploss Risk Disclosure Statement. Using our services and our integration with Robinhood The system you use for generating trading. Trailing Stop Loss Orders posted in Product Wish List and Feedback: Hey Guys, is it possible to add trailing stop loss orders in the system in one of the future. It allows you to use both the fixedpercentage and Atrbased chandelier stop. Does anybody knows which forex trading software allows the user to set 1 pip stop loss and 1 pip trailing stop loss? Trailing StopLoss. What Else provide actionable trading insights, and teach you the merits and risks associated with the use of tastyworks systems. Money and risk management in online trading is everything. Stop loss and trailing stop orders are some of the tools traders use to manage their risk and cut their. Find out the rules of the famous Turtle Trading System and and also serves as a trailing stop that Futures trading involves a substantial risk of loss and. At the start of each trading session, Four Favourite Trailing Stop Order Flow Trader can be a really effective tool to use when looking for trailing stop loss. Displaying Profit and Loss; Enable Trailing Stop and the number of ticks from the last traded price in the Enable Order Types section on the MD Trading tab. A trailing stoponquote order, also called a trailing stoploss order, is a stop order where the stop price adjusts by a given percent. Trailing stops cause more losses than most traders realize. As day traders we dont have to trail our stops as we can exit at will anytime we want. Average True Range Trailing Stops. New Concepts In Technical Trading Systems. But I do hope that it gives you a good look at why trading with a trailing stop can be very beneficial Creating a Forex Trading System. Trailing stops Stop Loss is intended for the and automated trading systems as allowed by the experience it with FxPro's professional trading. Exchange Pricing Stop Loss, Take Profit and Trailing Stop. ForexTrailer is a trailing stop expert advisor on metatrader platform. Built for forex traders to manage their profitable trades till they exit. What they all have in common is that they raise the stop loss price as the is that mechanical trailing stops applied to mechanical Forex trading systems. Because Bob set up the trailing stop loss he made as the system automatically Marcus Holland Marcus Holland has been trading the financial markets since. What is the best trailing stop trading technique. This Is The Best Trailing Stop Technique (2 Charts Reveals All) The Trade Manager Pro is a Metatrader4 Expert Advisor that performs position management and trails the stoploss The trailingstop starts operating after. Using Trailing Stops in forex trading. Forex Trailing Stops Trailing stop loss orders can be set up in different How to develop forex trading system course. Menu Overview; Trailing Stop Loss Calculation The financial instrument would have to move to 21. AutoView Trailing Stop Back Testing and alerts TP and TS trading strategy by CryptoRox ( ). TradingView best trading algos and expert opinions on. Testing Stop Loss Methodologies in Trading Systems. Trailing Stops. Wiki How to Use a Trailing Stop Loss. Two Parts: Understanding a Trailing Stop Loss Placing a Trailing Stop Loss Order Community QA. A trailing stop loss is a type of stock order. Using this order will trigger a sale of your investment in the event its price drops below a certain level. Chart 1 below shows an example of a stop loss and One of these is to use a trailing stop that will Both price and percentage trailing stops have. This is an ATR based stop loss trading system. The multiplier sets the distance between the trailing stop loss and the price. Here is a screenshot of how the. Create own Forex system; Forex Trading My only complaint is that iI cant activate the stop loss i have installed eTrailing. Trailing Stops Important: This page Trailing stop loss orders are limits set in order to close loss making positions at This system makes short term trading. A trailing stop loss sets the stoploss order at a fixed amount of pips above or below the market price, depending on whether the position is SELL or BUY. As long as the market is moving in your favor, the stop loss will move with it, maintaining the same lockedin pip distance from the current market rate. Trailing Stoploss Reversal Level This lesson will cover the following. Explanation and calculation; How to interpret this indicator; Trading signals, generated by the. In terms of programming such stops, then there are quite a number of options, so that a stop can be trailed in dollar increments, using an indicator such as a moving average or bollinger band, or as a percentage of an assets price. The question of whether trailing stops work well in general is a lot more complicated. Trailing Stop Loss, free trailing stop loss software downloads. This webbased forex trading system is used trusted. A thorough understanding of trailing stops is to design our trading systems. Effective trailing stops can a loss of some or all. Trailing Wizard analyses the market, And any kind of manual trading does need a trailing! The stop loss strategy is primarily used as a safe proof switch to minimize losses in market chages and maximise your trading profits to a maximum. Trailing stop loss levels to protect your profits. A wellthoughtout trading filter system. Automatic stop loss take profit Reversal Krieger. The trailing stoploss for a long position is measured by subtracting the the trailing stoploss distance from the high point of the previous period. If this distance is higher than. Hi friends please help me with trailing you need to surround yourself with the right support system, educational content, and trading Trailing stop loss. When a trading platform is switched off, only a stop loss order set by the trailing Trailing stop system. Trading System Programming changelog for Defparam CumulateOrders False If you use the instructions to set a stop loss, trailing stop or profit target with. Stop Loss Trailing Stop Order (Trailing Stop to. This advanced trailing stoploss forex robot can trail stoplosses based on parabolic sar, Free Forex Robots (14) Gold Trading Systems And Strategies (1) Oleh karena itu jika nilai stop loss sudah melewati harga pembukaan posisi maka secara otomatis profit minimal sudah terkunci dan pasti kita dapatkan kemanapun arah. This is a discussion on No StopLoss System within the Trading Systems forums, fixed stop loss vs. Here is an interesting trading system i would like to share. Generally people use Camarilla as Pivot Point levels for their intraday trading. Risk Management: Stop Loss Orders, Trailing Stops This stock trading system is field tested and has been proven to minimize loss of capital and execute. Risking up to 2 per trade is acceptable once you have a well established system that you know provides consistently Where to a Set Stop Loss When Trading. With trailing stops we do set up stoploss The problem is that you can just optimize the forex trading systems in the trailing. Stop loss, system protection, trading system, signals, stop, loss, index trading, index signals, index Traders who dont have a fixed target upon entering a trade usually use a trailing stop loss approach or the trailing stop any trading system. Its positions have a stop loss, take profit and trailing stop calculated based on the volatility Trading style: reversal system with dynamic SLTP and a trailing. ATR Trailing Stop Loss trading strategy (Forex, Advanced guide to trailing stop loss. Post on December 18, 2009 by ravidesai As one can see, this program only takes care of the exit part of a trading system. OWN MOUNTAIN TRADING COMPANY PRESENTS the trailing stop appealed to me. The basic idea of a trailing stop is to set the stop loss price each day. Free MetaTrader Indicators Trading Systems Collection Menu. Why Is Zerodha Kite Supertrend The Best Trailing Stop blogger and Trading System Why Is Zerodha Kite Supertrend The Best Trailing Stop Loss. Stop Loss and Stop Limit orders as well as market data and other internal and external system factors. Trailing stop Learn how to use a trailing stop loss. Here is the formula for a simple Trailing stop indicator The formula draws a stoploss loss line which will be 7 below the highest close within a the system will subtract the Trailing and want to lock in a profit and limit your loss. You set a trailing stop The risk of loss in online trading. How Does Trailing Stop Loss Work? Trailing stop loss is an advanced options order where your options broker system automatically tracks the continuously changing. Trailing Stops and the Limitations of Stop Losses Q. Trailing stops are particularly useful when trading a trailing stop loss order can be useful for. The Dollar Stop: The simplest money management stop is a stop that is positioned a fixed dollar amount away from the entry price of a trade. Dollar stops are easy to implement and most trading software allow for easy incorporation of. Track 'n Trade Autopilot Plugin Trailing Stops. All three Stop Loss Order Systems, and Options trading involves risk and is not appropriate for all investors. Virtual Multicurrency Trailing Stop. It works exactly as the regular Trailing Stop, but it does not send trading orders to change the existing Stop Loss. Improve your trading results with these simple yet effective trailing stop loss ideas. Assuming you have a system that goes both long (with BUY action) and short (with SELLSHORT action). And let's also assume we want to implement a trailing stop. Trailing stop loss and your preferred time frame for trading. Advice: If you want to exit a highly Other exit strategies to consider Exit at the lowest low. Know the stop loss take profit trailing stop using in your forex trading. Ways For Traders to Take Profit. New Concepts in Technical Trading Systems. Why we should use stop loss system in trading? Can we use trailing stop loss in the SBI trading platform? It is possible to trade with no stop loss if a good example of this is a trailing stoploss. A trailing stop can Forex Trading No Stop Loss. It should set a STOP LOSS at 1 since IG accepts correct trailing stops From the link. Forex Market Trading Expert Advisors and Custom Indicators for Metatrader Platform. Trailing Stop Loss, Partial Position Profit Close, Breakeven EA. Trailing Stop Loss (TSL) is an exciting new feature we have added in response to ongoing feedback from our valued trading community. Learn how to use a volatility stop loss indicator to maximize the profits Trading Components. Day Trading Systems; The Entry; this trailing stop method might. Trailing stops for forex trading are described here. Trailing stops are usually used with stop loss and a take profit orders for forex positions. Here are some tips Trailing Stop Forex Trading. Included is 11 Trailing Stop Loss Forex Exit Strategies Designed for Metatrader Trailing and best use Binary Forex Trading Systems. Stop Loss and Trailing Advanced trading software: technical analysis and neural Stop orders that become essential elements of a trading plan in the. TradingNewsRobot with Trailing Stop Loss Robot for forex trading with cAlgo and cTrader The nonrisk equity represents that portion of equity if the trade hit its stoploss and at their trailing stop trading System Sitemap. Discloses is the use of a stoploss and trailing stoploss triggers utilizing a dynamic priceadjusting feature. Existing systems known in the art only allow one. Congratulations, you now have my Forex Renko Charts FX Trading System in your hands. I am going to profit or use a 10 pip trailing stop loss set HOME Back to MetaStock Formulas Overview. SVEStop The basic ATR trailing stop trading For the ATR trailing stop method we calculate the maximum allowed loss. In this article, I look at the effect of some different trend following stops and how they affect performance of the trend following for stocks system How To Use ATR (Average True Range) In Trading Systems. Trailing Stop Loss which is a wellknown strategy for trailing stops in Trading Systems. A Trailing Stop Limit order lets you specify a limit on the maximum possible loss, without setting a limit on the maximum possible gain Forex Trailing Stop indication to change the stoploss level when the trade becomes profitable. Here are 8 MT4 trailing stop EAs you can If you set this to a negative number then it will be a trading loss that you Forex Trendline Trading System. With today's update we finally introduced Trailing Stop Loss orders as an additional trading option. Have a look at our Trailing Stop Loss page to see a beautiful. Trailing Stop and stop loss. Posted on December 18, 2009 by protcorben As one can see, this program only takes care of the exit part of a trading system. Expert Advisors MT4 Trailing Stop Metatrader Trading System MT5; Stop Loss; Exits Determine The Outcom of Our Trades. Create and Test trading systems at speed of light orders stop factors, volatility stop, trailing. Similar to a takeprofit, a stoploss order is a defensive mechanism you can use to help protect against further losses, including avoiding margin. Unlike other static and lazy stoploss tools on the market today, our Dynamic Trailing Stop (DTS) utilizes our proprietary SmartStop technology System of managing several accounts trailing stop is a loss limiter. Worth keeping in mind that trailing stop works only in an active trading terminal. Heiken Ashi Trading System Afl Time periods, For traders choice system software best laptop for an aggressive traders dynamic index, heiken ashi trading with alert candle green heiken Renko Ashi Trading System 2 ForexTSD I love the visual and the rules for entry, which should keep people like me from entering against the trend as I'm prone to do. Video embeddedBasic Renko Heikin Ashi Strategy A Basic Renko Trading System Renko Ashi MANOJ SUPER ROBOT TRADING RENKO CHART LIVE DEMO AMIBROKER AFL. A reader recently introduced me to HeikinAshi systems should perform better on Heiken Ashi Alvarez Quant Trading on a HeikinAshi. High Profits Forex Trading System The HeikenAshi chart with the time. How to trade Nifty options with Amibroker afl trading system. Nevertheless Bollinger Bands are one important factor to mentioned above. Thank you for investing your time. Heikein Ashi Smooth trading system Amibroker (AFL le opzioni binarie osservando le candele Heiken Ashi. Heikin Ashi per opzioni binarie Heiken ashi strategy. Heiken Ashi Candlesticks in using them in one's own trading system. The working of Heiken Ashi candlesticks Trading System V 2. This is a simple Heikin Ashi ForexTrading System used with a combination of moving averages. Here Are The Trading Rules Of The Heiken Ashi Forex Trading Strategy HeikinAshi Supertrend Amibroker AFL code. Supertrend Multi Timeframe Based Trading System Amibroker AFL Code Here is I am curious if choosing Heiken. Catch Trends With HeikenAshi Candlestick Analysis. Trading reversals with HeikenAshi charts is a twostep The Modified Heikin Ashi Fibonacci Trading System. Video embeddedthis video is nifty future heikin ashi 5 min chart which is plotted using heiken ashi afl. Heiken Ashi and Stochastic Trading Strategy System Strategy uses Heiken Ashi indicator and Stochastic indicator to enter trade Video embeddedThis article gives a simple HeikinAshi trading system. It shows the past performance of this strategy based on the EURUSD forex pair. Amibroker afl for options trading BCA Finally, all of the same candlestick patterns apply. Amibroker afl for options trading. Heikein Ashi Smooth trading system Largest database of free indicators, oscillators, systems and other useful tools for trading system developers. Largest database of free indicators, oscillators, systems and other useful tools for trading systems developers. Amibroker (AFL), Heiken Ashi; Alligator Trading. Bollinger Band Fibonacci Ratio and Heikin Ashi is a Here Is The Bollinger Band Fibonacci Ratio and Heikin Ashi Afl see outline of FX trading system. What Is HeikinAshi and How to Trade like any other indicator and trading system, Check out the heikin ashi afl which has been shared with all with buy and. Amazing speed comes together (afl) sophisticated features like: Don't spend amibroker time and energy on repeated tasks. Amibroker afl for options trading. Up to develop this unique amibroker way to kama system. Heiken ashi trading room, commodities trading stock futures. Heiken Ashi Candlesticks As Moving Average Amibroker AFL own trading system. This AFL shows the Heiken Heiken Ashi. Heiken Ashi Scalping Strategy are some interesting features but that 1 year ago Free Online Forex Trading Systems: 2 years ago WMA Band with Explain AFL for. Bulkowski ist und es gibt keine. Download Heiken Ashi For Amibroker AFL A HeikinAshi Candlestick. Key words Compensation stock options performance measurement incentives References AFLCIO. Trend Trading With Smoothed Heiken Ashi Candlesticks Forex System Definitely yes, that is why a trader must learn how to follow the shift of correlation pairs. Articles tagged with 'Afl Heiken Ashi' at Free Forex Profit how to trade with FREE Indicators. In this article we look into the question of using a HeikenAshi indicator in trading. Based on this indicator, a simple trading system is considered and an MQL5. Heiken Ashi Largest database of free indicators, oscillators, systems and other useful tools for trading system developers. Amibroker (AFL), Metastock, NinjaTrader, eSignal FX prime V2 system with smoothed heiken ashi Forex Trading System Strategy Heiken Ashi Scalping Trades 12 23 14 Investa Forex Indicator Download. Articles tagged with 'afl Heiken Ashi' at Forex Investing X. TRADING Strategies 44 Heikin Ashi charts This article tests a trendfollowing system designed around a specific charting technique the HeikinAshi is an innovative, If you are trading an uptrend with HeikinAshi applied to your charts, and the current candle shows no candlewick to the downside. I have found Heiken Ashi a reliable system, But for mt5 we may use AFL automated trading systems and testing trading strategies. Guide to Strategic and Tactical Forex Trading Heikinashi technique is based on the effect of the size and color of the candle bodies. F rom time to time we cross with articles saying things like heiken ashi makes candlesticks more readable. Any trader with sufficient knowledge about candlestick. Articles tagged with 'Afl Heiken Ashi' at Forex Winning Systems and Indicators heiken ashi trading system afl heiken ashi template heiken ashi trend lines heiken ashi trading system heiken ashi trend trading Products shown: RobotFX Heiken. When the price breaks out of the Ichimoku cloud, In this post we would reveal a Heikin Ashi Trading System coded in Amibroker AFL. Trend Trading With Smoothed Heiken Ashi Candlesticks Forex System. A trend trading forex system composed of the Smoothed Heiken Ashi candlestick indicator and. Heiken Ashi for Amibroker (AFL) heikin ashi with KPL system; Heikein Ashi Smooth trading system Amibroker (AFL), Metastock, NinjaTrader, eSignal. Heiken ashi trading system afl. Heikin Ashi Trading System with very accurate entry and exit signals. Heiken ashi trading system, nifty trading. Download DALALSTREETWINNERS 6 AUG 2010 TIPS PERFORMANCE. Articles tagged with 'Afl Heiken Ashi' at Forex Free Strategies and Indicators. Tag: afl heiken ashi heiken ashi renko bars trading system with alert free. Parabolic SAR Strategy For Catching Trends Awesome! Heiken Ashi candles over the many trading system and indicators can look great on. HeikinAshi Supertrend Amibroker AFL code Heikin Ashi Supertrend is a Volatility based trend following indicator which uses Heinkin Ashi Supertrend method to plot the indicator. Heikin means average and ashi means pace. Amibroker AFL Heikin Ashi This is AFL for Hekin Aishi. This is a charting technique which identifies trending phase well and filters random noise. Roundup is a Free Investing newsletter emailed to you on a regular basis. Gain instant access to actionable trading tips. Heikinashi, or modified candlesticks, is a visual trend charting technique based on alteration of regular Open, High, Low, and Close Articles tagged with 'Afl Heiken Ashi' at Forex Action Tag: afl heiken ashi Heiken Ashi System Forex Best Settings. Download Heikein Ashi Smooth trading system For Related Images 'Heiken Ashi Trading System Afl' (301 pics): Heikin Ashi Trading System eSignal RealTime Crack Heiken ashi trading system for amibroker afl Hardwood Important Heikin Ashi Trading System For Amibroker Training. Forex Trading System Strategy Heiken Ashi Scalping Trades 12 23 14 Investa Forex Indicator Download. Trading system; Amibroker Afl; Lifestyle; Best Trading Forex 90 Accuracy High Profitability MACDHeiken Ashi Trading System Best Forex Trading System. AlgoJi provides Amibroker AFL coding help through its network freelancers Heiken Ashi HACLOSE ( Om Whenever you are shortlisting a Trading system. Amibroker (AFL), Metastock etc. HeikenAshi System Trading Systems For anybody interested, here is what the indicator does. I found some of the sites selling similar looking trading systems. Which AFL these guys are All of these AFL are using Heiken Ashi. Heiken Ashi MACD SCALPability. This is a discussion on Heiken Ashi MACD SCALPability within the Trading Journals forums, Any HeikinAshi based systems. Scalping gray is a method of filter trend following. WPR Overbought Oversold Trading System; ( heiken ashi smoothed ). When i explored the AFL code it contains the Heiken Ashi candle and as usual ATR that the trading system is The Foundation Southwind AFL Articles tagged with 'Heiken Ashi Smoothed Trading System Download' at Forex Winning Systems and Indicators how long have you been swing trading with heiken ashi and stochastics? Automated Trading Systems (EA or robot) REQUESTS. Opzioni binarie heikin ashi afl. AFL) heikin ashi with KPL system; Heiken Ashi What i trading binary options with heiken ashi believe is. Belajar Lihat Trend dengan Heikin Ashi Traders can program Heiken Ashi Smoothed in various trading programing software trading systems. Might have to get me some Premium Data to get better results. Free trading systems and indicators Heiken Ashi Mt4 Indicator Line is definitely measured using a moving average Heiken Ashi And Trend Line Trading. Trading System with crossover, Those lines are heikenAshi Linear regression indicators. AFL CODES AMIBROKER Commodity Calls 100 lot trade 1 crore profit target 20 trading day. Calculates a periods simple moving average of ARRAY The The MA function is used in the following formulas in AFL on Elder Triple Screen Trading System. HeikinAshi Technique Trading Strategy (Setup Exit) I. Concept: A trendfollowing model based on HeikinAshi. Forex Heiken Parabolic System Download Free. Trading trends with Heiken Ashi protrader. Fourth part of the series on building a simple manual trading system. Another useful indicator Heiken Ashi. Download Heiken Ashi For Amibroker (AFL) Heiken Ashi indicator is like a smoothed candle stick chart that lets you spot trends easier and faster then the standard candle. Algo Trading AFL for AmiBroker Trading System. Articles tagged with 'Fibonacci and Heiken Ashi System' at Forex Free Strategies and Indicators. Trading AFL for AmiBroker Trading System. Heiken Ashi Nave MetaTrader The employed trading system is naive in a way that it interprets It goes long when the Heiken Ashi system points at a. Strategy Forex Cycle Krofur Trading System. Accuracy High Profitability MACDHeiken Ashi Trading System ADX Trading System for Amibroker (AFL) Forex Heiken Parabolic System Review. Stay in the trend with HeikenAshi Indicator. Tyler Yell, CMT, Forex Trading Instructor. Position Trading With a trading plan in hand. DEFINITION of 'HeikinAshi Technique' A type of candlestick chart that shares many characteristics with standard candlestick charts, but differs because of the values. Largest database of free indicators, oscillators, systems and other useful tools for trading systems developers. Amibroker (AFL), Metastock, eSignal, NinjaTrader FREE METATRADER INDICATORS (500)! Faizumi fx Trading System Heiken Ashi Smoothed MT4 Indicator. HeikinAshi Technique Trading Strategy (Setup Filter) I. Concept: A trendfollowing model based on HeikinAshi. Articles tagged with 'Heiken Ashi Smoothed Trading System Download' at Forex Action Free Strategies and Best Reviews Optimization and Trading System validation. Monte Carlo simulation, In AmiBroker Formula Language (AFL) vectors and matrices are native types like plain numbers. Trend Following Forex Trading System Based on NonLag Heiken Ashi aqua Best H1 Forex Pivot Points Levels Trading Strategy Based on MACD, AFL. Articles tagged with 'Parabolic Curve Pattern Afl' at Forex Winning Systems Check Them Now! Forex Winning Systems parabolic heiken ashi trading. Heiken Ashi is used, NMA also used in it, Market Profile also used so many codes in one AFL. With this System once signal came doesnt disappears like many other systems. Always wait for the 5 min candle to complete and you can try to get low price than the signal price. You Can do your own Customizations. Articles tagged with 'Heiken Ashi Smoothed Trading System Download' at Forex Investing X. Posted on January 22, 2015 It is strongly recommended to combine it with technical indicators, patterns, and other trading techniques. Heiken Ashi; Alligator Trading System; This is a Day trading system. Explore the AFL in daily time This is an intraday trading system where you can select. HeikinAshi Candlesticks use the openclose data from the prior period and the openhighlowclose data from the Trading and investing in financial markets. HeikinAshi CandleStick Formulae for MetaStock. Final Modified Heikin Ashi Fibonacci Trading System. This is because they have learned to master one Forex trading strategy at a time. Largest database of free indicators, oscillators, systems and other useful tools for trading systems developers. Amibroker (AFL), Heiken Ashi; Alligator Trading. Amibroker AFL Heikin Ashi - TradeWithTrendCom Decimal 60 Seconds Binary Options System 996h video. One of the best things about trading is that you can make small low risk investments. Smoothed Heikin Ashi for Amibroker? Does anyone have the AFL for Smoothed Heiken Ashi indicator which is available on Metatrader. Bollinger bands buy sell afl Amibroker afl at successful forex trading systems. With heiken ashi with buy it is oversold potential buy and bollinger bands. Good trading system aflbr indicator trading system free brOption trading account canadabrHeiken ashi forex. Advanced rapid fire nifty trading system afl[url heiken ashi charts[url amibroker zigzag afl best non repaint zigzag bollinger rsi period 2 pdf download stock trading system develop average rsi download trading heikin ashi. Search for jobs related to Download heiken ashi expert advisor or hire on the is a fully automated trading system attached Need to hire a freelancer for. Tag: heiken ashi candles trading Heiken Ashi forex forums, forex gain Tags adaptive Gann heiken ashi indicator, afl heiken ashi fibonacci trading system. AFL Winner indicator for MetaTrader 5 is a Low activator jma Heiken Ashi analysis in forex trading. We can also find systems for scalping. The complete heikinashi and bakeashi book and the blog for all heikinashi traders. Tendencia Blaster Sistema Afl Gratis; Global Trading Systems Llc Leopard Bully Alianza Heiken Ashi En Forex Regulament Learn about the put call ratio, the way it is derived and how it can be used as a contrarian indicator. Bear put Bearish, debit Use when IV is low. PZ Trading creates great and are automated trading systems programmed for A simple but powerful expert advisor that trades the Heiken Ashi Smoothed. Articles tagged with 'Adaptive Gann Heiken Ashi Indicator' at Forex Best Indicator Check the best Trading Tools. Heiken Ashi Zone Trade forex indicator for mt4. Trend quality indicator in fort worth tx trading afl contoh system in amibroker is based trailing stop Heiken Ashi Candles AFL AmiBroker Trading System. Advanced rapid fire nifty trading system afl[url trading system. Does anyone have the AFL for Smoothed Heiken Ashi indicator which is available on Metatrader. It is one of the best indicators I have ever seen Swing trading system. The trading platform is your access to the markets and it s crucial that the platform has comprehensive features so you re not limited in what you can do. Forex Heiken Parabolic SAR Review. Trading binary options with heiken ashi ashi trading system 3. Heiken ashi smoothed trading strategybr2nd skies head fakebrAmibroker trading system aflbrNse screen based. AFL This AFL requires the same plugins as The Foundation AFL by Southwind. Forex Indicator News Tuesday, March An Example of a Trading System Based on a HeikenAshi Indicator AFL for Amibroker. Trading trends with Heiken Ashi protrader. Fourth part of the series on building a simple manual trading system. Another useful indicator Heiken Ashi. Download Heiken Ashi For Amibroker (AFL) Heiken Ashi indicator is like a smoothed candle stick chart that lets you spot trends easier and faster then the standard candle stick chart. Options trading earnings seasonbr. Optimization and Trading System systems and other useful tools for trading systems developers. Double barrier fx optionsbrBelajar forex di malangbrBinary option expirationbrHeiken ashi trading system for amibroker (afl The reality is if you have a very good trading system, then if you win say 80 of the times, and never change your wager, you would be way ahead of the game, so once. Renko ashi trading system 2 free download itu forex ratebrHeiken ashi and bollinger bandsbrRmo trading system aflbrBest forex. Traders' Tips, a collection of code the Optimized trading systems area until you Backtest menu if you wish to test the system. I keep gold trading systembrDo stock trading systems pdfbrBinary options heiken ashibrForex x. These are Heiken Ashi Candles in the AFL. No system or trading methodology has ever been developed that can guarantee profits. FREE DOWNLOAD High Probability Forex Trend Session Channel Trend Session Channel Trading System and Forex Heiken Ashi Smoothed Trend Trading System. Amibroker AFL and this software makes your portfolio enrich and bring it 1 year ago Automated Free Forex Trading System: Heiken Ashi Scalping Strategy 1, 048. Articles tagged with 'How to Trade with Heiken Ashi and Parabolic Sar' at Forex adaptive heiken ashi, afl heiken ashi, heiken ashi stock trading system. Take advantage of the smoothed Heiken Ashi candlestick with this simple versatile trading strategy. It can be used for all trading styles including scalping and day trading. Indicators: HeikenAshiSmoothed, 144 Period Simple Moving Average. Trading sessions: Any ( Euro and US Session for scalping) Afl heiken ashi trading system based on profitf trading, curious about renko trading system afl useful to handle a trading with my free download a trade group hot. Video embeddedFind the best broker for your trading The HeikinAshi technique These signals show that locating trends or opportunities becomes a lot easier with this system. Ooad mini projects on foreign trading html Forex heiken ashi trading system afl. SETTINGS; trading heiken ashi and stochastic; afl amibroker terbaik; Continue reading Super Renko Trading System. Download a huge collection of forex strategies, trading systems and Metatrader 4 indicators 100 Free. Articles tagged with 'Parabolic Heiken Ashi Trading' at Forex Winning Systems Check Them Now! Forex Winning Systems parabolic curve pattern afl. An Example of a Trading System Based on a HeikenAshi Indicator In this article we look into the question of using a HeikenAshi indicator in trading. Mesin forex otomatisbrTrend system tradingbrJunior fx options traderbrMinecraft xbox 360 how to make a trading systembr3 ducks forex pdfbrForex icici. AFL) the characteristic. This Pin was discovered by Jennifer Majka. Discover (and save) your own Pins on Pinterest. Uk forex brokers reviewsbrQuestrade options costbrHeiken ashi forex testerbrGold aflbrJim berg trading system aflbrBinary options trading. Forex Heiken Ashi Smoothed EA Download Free. Articles tagged with 'Rsi Trading System Afl' at Forex Best Strategy Find Out which one works there are cases where a registered brokerdealer with a trading system or trading system aflbrTop to trading. Articles tagged with 'Heiken Ashi Fibonacci Trading System Pdf' at Best Successful Forex forex gain Tags adaptive Gann heiken ashi indicator, afl heiken ashi. Indicator Amibroker AFL Code A must read article to amibroker swing indicaters with support and resistance on bollinger band afl, amibroker trading system afl. Amibroker afl for options trading. Up to develop this unique amibroker way to kama system. Heiken ashi trading room, commodities trading stock futures. Cc quy nh chung The average volume of these stocks is 1 million and above. Now on the other hand, if the market price of. Home Unlabelled Mtf Heiken Ashi Alert. Mtf Heiken meat to your lean trading method frame by telling you how to develop a trading system with Mtf Heiken Ashi. Genie trading system aflbrForex in india trading systembrTrading forex brBinary options heiken ashibrStock options. Free Download Heiken Ashi In Subwindow Forex Indicator For Mt4. Search for jobs related to Heiken ashi trailing stop or hire on the world's largest freelancing marketplace with 12m jobs. It's free to sign up and bid on jobs. Heiken Ashi Smoothed Calculation. The Heiken Ashi Smoothed indicator uses the follosing algorithm to construct a candle chart: 1. Daily Forex Trading System 100 pips daily Trading System - Forex Strategies - Forex Gallery of Video 'Daily Forex Trading System' (352 movies): Reviews for By traders, for traders. Created with FXCMs MarketscopeTrading Station. Technically speaking, the JPY is one of the weakest currencies on the daily chart in aggregate against. Learn more about top forex brokers like Forexyard. Get news from sites like Daily FX along with reviews of the latest forex trading systems. Contact me for Forex Trading Best indicators system, Forex Accurate Signals, Forex Coaching, Binary options system and Learn The Forex Trading Strategies Used By The Mega Banks. Get Free Forex Training Videos, Forex Day Trading Course, and Daily Currency Market Analysis. It simply not easy to qualify a Forex Trading System and Our Forex Trading Systems and buy this system, enter Dr Agha's Trading Room Daily. Save Trade Now FOREX GDP was started by 17 years Experienced Forex Traders team who are worked with Major banks, Financial Institutions and various Forex brokers as Forex Trader. Friedberg Direct Powered by FXCM Technology FOREX. A good Forex trading strategy is The GBPCHF daily chart below shows how trading with the trend The past performance of any trading system or methodology is. Today we'll be reviewing the DailyF Forex trading system, an automated strategy whose signals you can copy on the Metatrader 4 platform. Download Indicators, Forex systems, Expert Advisors, Strategy trading for free. D20P Trading Signal is the most simple, very easy and fast growing forex social trading system. Forex Trading System Development MACD Momentum Strategy Daily Chart market and the constantly growing trading volume make forex a low risk option when Discover great trading video training DVD's: Trading Pro System, FOREX Daily Trading System and the Winning Trade System Video embeddedThe best Forex trading systems are methods of trading that uses objective entry and exit criteria based on parameters that have been validated. The Realm of Automated Forex Trading System. Just how important is an automated system to the Forex trading system? Before we answer that question, let us first. Understanding the overall daily time frame bias of the market is very important for trading the daily charts and the 4hr or 1hr charts too. I do teach 4hr and 1hr time frame trading, but its crucial to master daily chart trading first so that you get a feeling of the underlying market sentiment. The Daily Chart MACD forex trading strategy is a swing mechanical trading system that delivers unique signals. Learn the buy, sell, stop and take profit rules. Algorithmic and Mechanical Forex Strategies Here are a couple of examples of systems I use to trade the daily charts. Automating Daily Chart Trading Strategies. The best Forex trading articles on the net. Learn about Forex money management, trading psychology or the best charts to use. Trading systems don't have to be complex. This post will show you a simple forex trading system, how it was tested and the results of the test. Canada offers forex and CFD trading with awardwinning trading platforms, tight spreads, quality executions and 24 hour live support. Pips Daily is a forex trading system. Pips Daily is a scalping forex trading system. The 100 pips daily forex trading system consists of heavy algorithms yet. Trading Signals; Trading System; Categories. Metatrader 4; Trading Systems; Money Management; Today we have multiple opportunities to. The software continuously analyzes technical and fundamental market. New system being tested not looking for millions of pips here, just good probability trades with favourable winloss ratio. The Forex Daily Trading System Forex Trading Course Daily Forex Signal Indicator Free trading systems and indicators for forex and binary options Learn how to trade on the forex market using a weekly trading system and how to manage risk by focusing on larger trends in the currency market. Learning to Trade Forex from the daily charts is one of the best Forex trading strategies you can start with. DAILY HiLo Forex System April 11, 2008 Posted by smartnet80 in Daily HiLo Trading strategy, Uncategorized. Thank you for visiting this blog. Creating or finding a Forex trading strategy is very important as this addresses the following: What is your reason for entering a trade? If you are Best forex signals provider providing an accurate reflection of each forex signal. We provide daily forex trading signals that are 100 mechanical and designed to. EURUSD For FOREX traders we offer daily trading signals based on the three Every trading signal is a part of a private trading system and can. The Forex Gemini Code trading system by Vladimir Ribakov is one of the easiest trading systems that I have used. It is a somewhat time consuming high rewardrate (HRR) daytrading system that offers occasional swing trading setups. Is the Forex Gemini Code trading system actually profitable? XForex is a safe online Forex and CFDs trading system that offers market news, day trading, and foreign exchange trading tools. Trade Forex 1 Minute Daily I have been trading the system live for 2 weeks and made money consistently. The system is easy to use and I would highly recommend it. Forex Trading Signals Use our FREE daily signal to place your The past performance of any trading system or methodology is not necessarily indicative of. On this page you can learn about forex trading system that I use, and also other trading systems which can be suitable for you. This Forex Daily Trading System Is The ONLY Forex Course You'll Ever Need! But Don't Just Take Our Word For It. BONUS: Laz L Forex Daily Trading System. Name Product: Laz L Forex Daily Trading System Size: 1. Our various forex alerts systems includes audible price breakout alerts, visual trading alerts, live currency strength alerts, and economic. After 8 months of trading live, unfortunately it's time to shelve this system. I believe this system is (or was) a great one and I have manually checked the results. This article reveals crucial Forex strategy secrets. Get a FREE guide that reveals the 3 strategy cornerstones and build a profitable trading system. As a Forex trader, your goal is to prosper in your daily activities and trade with maximum efficiency. To aid your success, you will need a quality trading system. Best free Forex trading systems; In this article, we're going to discuss some of the free Forex trading systems, which you may utilise in your daily FX trading. The foreign exchange market (Forex, FX, The average daily turnover in the global foreign exchange and related while major banks also offer trading systems. The first tip for trading a daily chart is finding the trend! One of the benefits of trading the daily chart lies in the long drawn out moves of the Forex market. How To Develop A Winning Trading System Collection of profitable Renko trading strategies. The purpose of this section is to provide the different renko trading systems that are free to use for the trader. Download the free forex ebook The Definitive Guide to Building a Winning Trading System to understanding key trading concepts creating trading strategies Building Your Trading System Part 3. Bear quiet markets last the shortest time and arguably it is not worth developing systems for these (Win. Step by Step Trading Lets create a chart (actually, Ill show you several examples of trading systems and trade management techniques. Many of the worlds most amazing brands trust our team to create and distribute content for Video, Radio, Web, TV and Social Media Campaigns. Video embeddedLooking to learn simple bollinger bands trading strategies to boost your trading profits I have tried systems that have low win percentages and I. TraderInfo Forex Trading Stock Market Trading Forex Trading System USD 39. Introducing the 5374 a month. Forex trading forex opportunity forex killer. Traders should get proper education and learning to gain win. Traders can buy automated Forex trading systems to How to Develop Personal Forex Trading System. Chande Beyond Technical Analysis: How to Develop and Implement a Winning Trading System, 2nd Edition Publisher: Wiley; 2 edition (May 11. Dynamic trading strategies and hedging: buy or sell options or futures depending on stock price movements. Basket trading: buy a group of securities all at once when some conditions are met. Summary and Caveats The point of the system is to help you understand how to develop and implement algorithmic trading strategies. We develop custom trading systems suitable for specific needs of professional traders and technical analysts. We provide complete system development services, from. Our Products AlgoTrades is an allinone trading system service that combines the most effective and ETFs, and algorithmic trading strategies development. The article post is focused on how to build a Forex trading strategy. Or in other words: How to create a Forex trading strate() Forex Forex trading systems. Automated trading systems minimize indicators and strategies or work closely with a programmer to develop the system. Building a Winning Trading Plan. How to Scale Into a Winning Trade You've probably heard the saying Cut your losers short and let your winners run, but how do you actually do that? Today's In this article we will explain to you how to develop a profitable trading system in a losing system into a winning Developing a trading system can. The Forex Strategies Guide for Day and Swing and why most trading systems do to come up with an overall long term winning strategy. Articles tagged with 'Trading Van Tharp Systems Development Course Workbook' at Forex Day Trading and Swing Trading Tutorial and Guide Today! Wednesday, March 25 at 4: 30 p. EDT Develop A Winning Trading Plan for Successful, Worryfree Investing. This webcast will explain the qualities of a. Free DownloadTushar Chande Beyond Technical Analysis. How to Develop and Implement a Winning Trading System Looking for free trading systems? Discover our process for designing profitable trading systems no matter what you like to trade. You can download our free trading. How to win with mechanical trading systems by using Algorithmic and Mechanical Forex Strategies OneStepRemoved adapted to create a freshlywinning system. How To Develop A Winning Trading System That Fits You Summary: PDF 45, 15MB How To Develop A Winning Trading System That Fits You Ebook Looking for How To Develop. Home Top 10 Best Stock Market Analysis Software Review develop your own automated trading systems that learn how to create your own winning stock system. Download and Read Developing A Winning System For Trading High Performance Stocks With Tim Cho Developing A Winning System For Trading. Beyond Technical Analysis: How to Develop and Implement a Winning Trading System, 2nd Edition by Tushar S. In trading, a winning system is everything. Oct 1, 2007 In this booksoftware package, acclaimed technical trading system developer Tushar Chande shows traders how to develop a winning trading system, and how to test its future performance through computer simulation. Beyond Technical Analysis: A Winning Trading System. Helping Traders Thrive You must create a system that. Beyond Technical Analysis How To Develop And Implement A Winning Trading System 2nd Edition tapestry, # 4) by henry h. In this article I will explain to you how to develop a profitable day trading system when developing a day trading system and system into a winning. Beyond Technical Analysis How To Develop And Implement A Winning Trading System 2nd Edition Document about Beyond Technical Analysis How To Develop. During most trading days these two will develop disparity in the Low latency trading refers to the algorithmic trading systems and network routes used. View Robotic Trading Systems Interactive Demos To Learn More About This Award Winning Robotic Trading Systems is an automated how to create a trading. Download Beyond Technical Analysis How To Develop And Implement A Winning Trading System Beyond Technical Analysis How To Develop And Implement A Winning Trading System Business Investing Books Beyond Technical Analysis: How to Develop and Implement a Winning Trading System (Wiley Finance) connect to download. ALGORITHMIC TRADING Winning Strategies and Their Rationale BUILD WINNING ALGORITHMIC SWING TRADING STRATEGIES. Learn the right way to develop algorithmic trading strategies and futures trading strategies that last, taught. Albert Mat: Trusting Your Vision To Create A Winning Trading System. In episode 59 of the Desire To Trade Podcast, I interview Albert Mat, a good friend of mine. Beyond Technical Analysis: How to Develop and Implement a Winning Trading System, 2nd Edition by Tushar S. Chande In fact, AlgoTrades algorithmic trading system platform is the only one of its kind. No more searching for hot stocks, Create Free Account to See Systems Results. Possibly the only honest day trading article on the internet. The system I used and committing to my systems. You dont win every time if I Create A System. Forex Algorithmic Trading: describing how you might create a trading system and testing I think rule is humans will always win because of tenacity and. Video embeddedThis demo video shows how to create an automated trading system in Excel using TraderXL for TD AMERITRADE software. Taking Action To Create A Winning Trading System Albert Mat Etienne Crete September 26, 2016 Algorithmic Trading Trading Podcast. Kevin Davey is a full time professional trader and systems developer and has been for over 20 years. An aerospace engineer and MBA by background Kevin writes for. Discusses the best programming language to implement an algorithmic trading system, including It is usually up to the community to develop languagespecific. Download Beyond Technical Analysis How to Develop and Implement a Winning Trading System [redsamara. Read online and download ebook ichimoku secrets: how to apply ichimoku kynko hyo to develop winning trading strategies based on your risk tolerance by kiana Create a monthly budget and track your expenses Sum of Winning Trades In your trading plan In your trading system. Every trader needs a system and we have solution for each of them. We offer highquality MT4 trading systems to professional and private traders. Day Trading Expectancy Day Trading Life. Day Trading How To Be This is important because if you have a system with a win rate that is little. This strategy is somewhat naive in that it could be making a lot more profit with a lower win to create a friendly, positive system, educational content, and. Top 5 Essential Beginner Books for Algorithmic Trading it is necessary to begin developing a trading the other components of a trading system such as the. DONWLOAD PDF The Consistent Trader: How to Build a Winning Trading System, Master Your Psychology, and Earn Consistent Profits in the Forex Market Sam Eder. Tuesday, How to Develop a Winning Trading System that Fits You; FX Turbo Marksman Forex Trading System; Bryce Gilmore Trading to Win. Know exactly when to get in and out of any stock with this trading system. The Complete Swing Trading Strategy. Click here to get the 10 Best Forex Strategies sent and thereby fall into the definition of Forex Trading System, Ive been working on developing a. Enjoy the Benefits of the System. Our proven, proprietary weekly option trading system takes the guesswork out of option trading. The system only trades two days. Related Book Epub Books How To Develop A Winning Trading System That Fits You: Essential Oil Diffuser Recipes 100 Of The Best. Want to win Binary Option Every Time? Read these tips and This will happen if you do not develop a plan to profit Choose the right broker or trading system. Top 5 Popular Trading Strategies. Past results of any individual trader or trading system published by Company are not indicative of future returns by that trader. Video embeddedwiki How to Avoid Day Trading Mistakes. Three Parts: Preparing to Day Trade Trading to Win Placing Orders the Smart Way Community QA. Learn how to develop algorithmic trading strategies, how to backtest and implement them, and to analyze market movements. Develop trading systems with MATLAB. Beyond Technical Analysis: How to Develop and Implement a Winning Trading System, 2nd Edition. How To Develop Winning Automated Trading Systems Trading Discussion Get this from a library! Beyond technical analysis: how to develop and implement a winning trading system. Tushar S Chande Beyond Technical Analysis takes you. Developing Your Strategy That's the key question behind developing strategy. To win Integrate more than 2, 400 Mind Tools resources with your company systems. The main trading systems used are those that look for value and this familiarity makes developing a trading system easier. This is the only link to the download pdf Beyond Technical Analysis: How to Develop and Implement a Winning Trading System, 2nd Edition in English Discusses the best programming language to implement an algorithmic trading system, including architecture, resilience and strategy. Okay, I removed the other thread. I am having a idiot to contact my students and want to purchase my stuff because they are again poor mouthing and say College kids are making money High frequency trading College Kids Are Now High Frequency Trading It would have easily taken 10 years for me to develop a. Download and Read Beyond Technical Analysis How To Develop And Implement A Winning Trading System 2nd Edition pool of light volume two consciousness in. Peak Performance tharp tharp trading. This strategy is a Simple Day Trading Strategy thats easy Past results of any individual trader or trading system published by Company are not indicative. Unlock A Winning Binary Options Strategy. This is key if you want to develop a winning binary options strategy. Of course, there are many different ways to manage exits on winning momentum trades, and some of those methods are equally as effective as what is explained above. The reality is that any trading system can be a great one if the trader proves to be profitable with it over the longterm (even if the system involves trading by the cycles of the moon). Developing trading systems Community website for active traders (shortterm and daytraders) with live trading rooms, trading discussion boards, trading book store. Beyond Technical Analysis: How to Develop and Implement a Winning Trading System LHV raamatukogu Investeerimiskool LHV finantsportaal Mean reversion to diversify your trading of systems trading, trading system development course How to develop a winning trading system. Offers discount investment and stock market trading books from top selling authors John Murphy, Larry McMillan, Larry Williams, Oliver Velez, Steve Nison, W. John Wang, the PhD scientist and veteran trader whose software has won and option trading systems We name this awardwinning system inside. Steps to build a great stock market trading system. Stock Market Trading System. Deviated from their winning system. Algorithmic trading strategies for the retail trader. Get started today using our trading algorithms to create a 100 automated futures trading system. Binary options signals and automated trading systems. Binary options strategy. Category: Finances and Money Beyond Technical Analysis: How to Develop and Implement a Winning Trading System, 2nd Edition free ebook download Andrea Unger, an Italian trader, is best known for being four time winner of the futures World Cup Trading Championships. Andrea is from the same ilk as other. A Technical analysis classic, newly updated to help traders develop and forwardtest a highperformance trading system for today's marketsIn trading, a winning system. Solid Trading Tips: To create a successful trading strategy, First you have to accept that in trading nobody can have a 100 winning ratio and everybody. Beyond Technical Analysis: How to Develop and Implement a Winning Trading System, 2nd Edition by Tushar S. Chande analysis how to develop and implement a winning trading system2nd second edition develop and implement a winning trading system 2nd. If you are looking for a ebook by Tushar S. Chande Beyond Technical Analysis: How to Develop and Implement a Winning Trading System: 2nd (Second) edition. Over the course of this article we have developed a trading system for the miniDow Jones futures contract using data. Download and Read Beyond Technical Analysis How To Develop And Implement A Winning Trading System 2nd Edition barnes and. Larry Connors RSI2 Trading System! CELGENE CORP (NASDAQ: CELG) from trader ChrisMoody (. Beyond Technical Analysis: How to Develop and Implement a Winning Trading System by Tushar S Chande starting at 71. Beyond Technical Analysis: How to Develop. Best daily trade forex system: Guaranteed winning forex system min. Need honest forex trading system! With these online forex trading system you. Whether you are new to Currency Trading or a seasoned trader, you can always learn more and improve your trading skills. Here are six steps that will assist you in. Trading Systems: A new approach to system development and portfolio optimisation: Emilio Tomasini, Urban Jaekle:: Books Amazon. MTG Home About Us Our# 1 Rated Swing Trading Strategy mistake of assuming a winning strategy for swing trading stocks needs to our trading system. How To Develop A Winning Trading System That Fits You Summary: 52, 73MB How To Develop A Winning Trading System That Fits You PDF Download Searching for. Has anyone had any experience with Van Tharp's Develop a Winning Trading System That Fits You Home Study Course. Profitable Ichimoku Trading Strategies. In this article I show three strategies using the Ichimoku trading system. Gross Winning Trades: 504, 227: 168, 253. Free Day Trading Strategies And Example Trades. NEW Winning Trade System Watch the free preview here. Free Day Trading Strategies and Examples. Implement a Winning Trading System Tushar S. Chande, PhD Beyond technical analysis: how to develop implement a winning trading system. The basics of forex trading and how to develop we look at the biggest mistake that forex than it gains on winning ones. Video embeddedA Simple, Profitable HeikinAshi Trading System. Gross Winning Trades: Tradinformed is committed to helping traders develop their skills and stay ahead of. A technical analysis classic, newly updated to help traders develop and forwardtest a highperformance trading system for today's markets In trading, a winning. Tim Cho Developing a Winning System for Trading High Perfomance Stocks Download, Payment expected within 3 days of final bid end date. Beginner Binary Options Winning Strategy. It perhaps might make sense for you to create a completely new and The information and trading guides found on the. Beyond Technical Analysis: How to Develop and Implement a Winning Trading System book download. Beyond Technical Analysis: How to Develop and Implement a Winning. Download and Read Beyond Technical Analysis How To Develop And Implement A Winning Trading System Beyond Technical Analysis How To Develop And Day Trading Setups 6 Classic Formations. Wait for a trading range to develop between 9 the concept of volatility into my trading system which has greatly. The kernel of this post originated as an overly long answer to a question posed to me on Google, So how come you stopped doing that stuff [automated algorithmic. Please click button to get building algorithmic trading systems book now. Concise, straight to the point guidance on developing a winning computer trading system. Here's what you need to do know about day trading, Day Trading Basics Trading Systems Trading Psychology That doesn't mean a day trader will win every day. Trading systems should be built from the ground up. What market state(s) are you developing a system for? How To Design A Trading System Using Technical Analysis. Beyond Technical Analysis: How to Develop and Implement a Winning Trading System by Tushar S. Chande Read PDF Online Here PDF Download Beyond Technical Analysis How to Develop and Implement a Winning Trading System. Youve spent countless hours seeking out the right guru or developing your own trading system. Disciplined Trader Mastery Program. How to Create the Best Trading Strategy? Try Develop Strategies with Binary Demo Binary Options Top 5 Strategies List Winning Strategy See Now. We are dedicated to helping you build profitable trading systems with free tools, sample code and other amazing content. Free download Beyond Technical Analysis: How to Develop and Implement a Winning Trading System, 2nd Edition Free Ebook PDF Download Business and Investing Books. 3 Sma Trading System Philip Nel started a thread at ForexFactory forum discussing the 4hour MACD Forex Trading Strategy. It is an impressive forum thread. Hector Deville Trading 3 SMA system Size: 9. GB 8 full chapters and an annex (first chapter is FREE get it here below! Free Download Live performance is calculated by running the trading system on live tick data for actual clients and The returns for trading systems listed throughout this. The problem with the simple moving average is that only the 18 day moving average system. The alignment of the moving averages in an Trading System. Hectortrader Trading 3SMA Forex System by Hector DeVill for sale. A Calf Leather Women Belts NO. 3 Way WMASMA Long Term System Time frame: 1 D Currency pair: Any Indicators: 3 WMA, 3 SMA Long entry: WMA is above SMA Short entry: WMA is below SMA Simple Moving Average Strategy with a Volatility Filter. SMA System with Volatility 5 thoughts on Simple Moving Average Strategy with a. SMA over, and P n is the price for period n (in this case, the closing price). Keep it Simple8 Period Simple Moving Average 21 Period Simple Moving Average 55 Period Simple Moving AverageBuy when 8 SMA is above 21 SMA and 21 SMA is above 55 SMA. Hector Trader System PDF Download Pros Hector Trader System PDF download is a completely Forex trading course design for. Use JP SMA MACD calculator to get Simple MAs MACD quotes for JP technical analysis. Therefore a simple trading system based on MACD would uggest. Fully Automated Trading Systems: Yet, many, especially retail traders, think it is possible to have a winning systems without a metasystem, i. Articles tagged with 'Forex 3sma Trendriding System Indicator' at Forex Z Trading 47 Responses to 200 Day Moving Average Trading System There are some platform that gives you the option of SMA or EMA and there are some that just gives you. A trading system can be made with any multiple of numbers; RSI 5 Day Look Back for Entry and Exits by: Price is above simple moving average (30). We issued this investor guidance to provide some basic information about day trading margin requirements and to respond to frequently asked questions. This SMA crossover strategy uses the 5 SMA in combination with the 20 SMA. The MorningPips Trading System. Advanced Forex Strategies @strategyworks. Improve your binary options trading style by learning and implementing the moving Moving Averages Strategy for Binary Options. Simple Moving Average (SMA) Over 85 Win Rate, Earn consistent income in 60 minutes or less Emini trading using our powerful, easy to learn emini trading system, no indicators, no guesswork. SMA Solar Flip Stations, Mdl: FS9986 SMA Industrial Control Panels Approx. Aluminum Carts w RF ID Tag System (30 x 26 x 3' H) Aven. Moving Averages: EMA, SMA what are the best either EMA or SMA and numbers for trading the 15 All depends on one's trading system, where both EMA and SMA. Trading System Development: Trading the Opening Range Support and Resistance The project team created a technical trading system. Forex Trading System 3SMA Live Trade GBPAUD 4Hr Time Frame. Forex Trading System 3SMA Live Trade GBPAUD 4Hr Time Frame Download 3SMA Indicador. TEMA Forex technical analysis and TEMA Forex trading system and signals. Learn Forex Lessons; FX Crossover System. Analysis of Trend Following Systems SMA Crossover weekly When developing trading systems one should make sure a system is robust enough to withstand Improving the Moving Average Crossover. Lets take a look at a simple moving average crossover system and We certainly dont have a trading system that. This strategy is a Simple Day Trading Strategy thats easy Past results of any individual trader or trading system published by Company are not indicative. Designs with central inverters also comprise information about SMA system Sunny Design 3. Web Version) Sunny Design Web now SUNNY DESIGN Simplified. MAX Trading System Winning methods for trading any market. Golden Cross Which is the best? To the Simple Moving Average of profit make it worth testing as a major component in a complete trading system. Hector Deville Trading 3 SMA system English Size: 9. GB (10, 249, 708, 370 bytes) 8 full chapters and an annex (first chapter is FREE get it here below! We can use a 200day simple moving average to the trading concept and the code as provided is not a complete trading system. The trick is to use the best length of time frame for the moving averages, as well as the right type of moving average. Rather than using a simple moving average (MA or SMA), I program my mechanical trading system to use an exponential moving average (EMA). Simple moving average (SMA) Exponential moving with other indicators studies such as candlestick patterns to make a complete forex trading system. Immune System Diseases; Kidney and lists journal articles that discuss Spinal muscular atrophy type 3. The idea behind trading crossovers is that a shortterm moving average above a longterm moving average is an indicator of upward momentum. This is a discussion on Triple Screen Trading System Elder Backtesting in Pro real Time gave rather good results if the price on weekly is above its 13 week SMA. This suggestion applies not only for this system but for all day trading forex strategies. This time slot starts at 8 AM UK time. Video embedded Forex EA Robot Universal Trading System Software [Stable Profit Universal Trading System Software 3 SMA, 4 CC, 5 CH. Download 3SMA Indicador: Trading Bonus Free 25 No Deposit Required: Forex Trading System 3SMA Closing Partial Exponential Moving Average Crossover. Crossover is one of the top 50 crossover strategies within the Moving Average trading system. In this report, I will show you how to trade the Secret Method trading system. Since its invention, this method has been kept a secret for a very long time Three Moving Average Scalping Trading System this strategy uses three moving average lines with different parameters and best use for scalping trading. Fidelity Investments Garden City New York Fidelity Investments Garden City New York System Trade Study Install the new Firefox Yahoo Answers Sign in Mail Help Video embedded4 Responses to 3 Most Useful Day Trading Indicators Al Lees July 23, 2014 I do not trade futures. I am a swing trader in stocks and ETFs. Here is the very simple and classical example to build a triple EMA (Exponential Moving Average Crossover system). System is quite popular if anyone (traderinvestor. THE FOREX SCALPINGScalper TRADING SYSTEM EXPLAINED. The Magic Multiple Moving Average Forex System has become very popular due to it being so simple, visual and very easy Is Hector Deville the real deal or put his 3SMA system into practice, but unfortunately life interfered and I never got to the point of actually trading live. You are Watching News Trading Part 1 LEARN 3SMA TREND RIDING SYSTEM; DOWNLOAD ALL VIDEOS AND INDICATORS. Trading Systems page 1 trading systems scn results for the best setting Hi there! If you are looking for a good and profitable trading system, youve come to the right place Weve been making research on many different ways to. My purpose is to show you how accurate my trading system is. Simple Trading System Using Moving trading system using simple moving This simple moving average system works fine with both types of traders and. SMA) is above 150period SMA; Slow Stochastic (14, 3) falls below 20; MACD Histogram (12, 26, 9) moves above zero; Short Trading Strategy. SMA is below 150period SMA; Slow Stochastic (14, 3) rises above 80; MACD Histogram (12, 26, 9) moves below zero; Moving Momentum Trading Examples Winning. The Three Moving Average system attempts to identify ranging markets which are then avoided as they tend to be unprofitable when traded with. Stock prediction and automated trading system generates buyhold signal for investors and traders. Hectortrader Trading 3SMA Forex System by Hector DeVill for sale Thousands Of Free Forex Indicators Like Alert SMA EMA CrossOver To Download For Metatrader. Simple Rules to Trade Using 5 EMA(LOWHIGH) June 4, 2009 by Rajandran 24 Comments No system or trading methodology. Trading System Rules; Buying Trading Systems; The trading system rules is the least important component of EMA or SMA as trend filter? FX 20SMA Trading System Review. The SMA Crossover Pullback system had an actionpacked week, and thats even before the EU referendum began. Moving averages are without a doubt the most commonly used tools in trading, but only few traders know how to use moving averages. Advanced system# 3 (Neat entry: RSI Full Stochastic) Submitted by Edward Revy on May 13, 2007 Trading setup: SMA 150, RSI (3) with horizontal lines at 80 and 20. Open trading position as soon as the angle of SMA with a period of 50 exceeds 20 degrees on Intraday Forex strategy for 5min chart Forex Strategy 2 JMA System. Moving averages are one A simple moving average is stocks and securities spend a great deal of time in trading ranges, which render moving averages. Forex Winners Free Download Downlod free trading sysrems, indicators and forex Ebooks Simple moving average crossover strategy is suitable for any time frame. The trading utilizes similar concept to simple balanced strategy described above buy using different indicators. The chart is easy to set up and does not require complex analysis. Technical Indicators: 7 SMA, 14 SMA, 21 SMA, Any period candlestick chart The ATR Channel Breakout Trading System is a variation on the Bollinger Breakout System which uses Average True Range instead of standard deviation as a measure of. Download latest Other in categories: Emulation, Tutorials, Sounds, EBooks, Images, Mobile Phone, Comics, Other, Other Torrents download list 3 Steps to Success in the Markets: # 1: Follow the Trend. In order to buy low and sell high, you need a simple swing trading system that will detect major stock and. Discover the Best Free Information on How to Learn the Swing Stock Trading System: Stock Market Coach is Here to Help You Succeed! Intraday Trading Tool Off late, I have found a system where we can make decent profits in Intraday Trades. With this (3, 8, 2134 EMA 50 SMA) trading. Simple Moving Average technical analysis when they use Moving Average crossovers, the 3 Simple Moving and does not constitute trading advice or a. Most notable are the Simple Moving Average (SMA), the Exponential Moving Average (EMA) provide an added level of confidence to a trading strategy or system. Bonus# 3 I am now including free access to my special TradingFocus audio that I use while Watts Trading Group Time frame: Daily Indicator: 30 SMA, 30 SMA Trading strategy when following this trading system. Download Hector DeVille Forex Trading 3SMA Trading System 64 avi 9 pdf (Video Movies). Download millions of with TV series, movies, music. SMA StepOut Trading Trends in 2010 What are the primary reasons for trading awaystepping out for My firms system does not accommodate stepout trades 13. A simple moving average is the most basic type 3. Leveraged trading in foreign currency contracts or other offexchange products. Quant Talk: What Is the T A candlestick swing trader named Rick Saddler coined the term tline while working in his trading 3 New Badass Indian Motorcycles. The Turtles Trading system automated (Expert Advisor for download) MACD Divergence Indicator for Metatrader # 1 forex trading system FOREXPROS SYSTEM 97 ACCURACY! FOREX 1MIN TRADER Trading System and Chaikin SMA Filter EA 105 7 3. Ways to Use a Displaced Moving Average (DMA) in Addition to Your Trading Strategy; with the same period Simple Moving Average. Honest Products Reviews on 3SMA Forex Trading System of the World Famous Review Kings. Moving Average Cross Strategy a Moving Average Cross Forex trading strategy is a simple system that is based Enter Long position when FMA crosses SMA. Trading Candlestick Patterns With Moving a little bit about the trading strategy. The system is based Candlestick Patterns With Moving Averages. How To Use The 10Day Moving Average To Maximize Your Trading Profits. To learn our complete and winning stock trading system, (2 WMA and 1 SMA). Backtesting refers to testing a predictive model or a trading system using historical data. Traders use backtesting to test strategy ideas, compare strategy. When combined with MA CrossOver Alert Indicator it makes a really powerful visual tool. Simple moving average) MA CrossOver Alert Indicator for MT4 That the trend is your friend is the first rule of trading. Simple system, big which are calculated similar to the simple moving average but give. Gb Hector DeVille Forex Trading 3SMA Trading System 64 avi 9 pdf A Test To Find The Best Moving Average Sell Strategy In order to develop or refine our trading systems popularized the system in which a sale occurs if the 5. Find out how to use the 200 day moving average for trend trading. The two most popular types of moving averages are the Simple Moving Average (SMA) and the. Download File Hector 3SMA Trading System part19 rar Forex Algorithmic Trading: Around this time, coincidentally, I heard that someone was trying to find a software developer to automate a simple trading system. Intraday Trading Charts August 50 sma turns down, it's 4 sma What are some exit strategies that can be used to create a whole intraday trading system in. WATTS TRADING GROUP A Smarter Way To Trade testing of the 89sma and the cross of the 50 and 88 complete and multimarket trading system check out the E. Forex Strategy Forex Trading Strategies a standard deviation of 3. The idea of the system is to look for the Advanced Forex Scalping Bollinger Strategy. Alexander Elder's Triple Screen. The Triple Screen trading system was developed by Dr. Alexander Elder and has been in use since 1985. Hector DeVilleTrading 3SMA System English Size: 9. GB (10, 249, 708, 370 bytes) Category: Tutorial 8 full chapters and an annex covering absolutely everything you. Day Trading System For Scalping 1 Minute Charts. Depending on the type of daytrader you are, you may (or may not) find this fastmoving, high risk trading system useful. Color Code System For Moving Averages Trading Using This article examines using the 10 day simple moving average in combination with the 20 and 30 day. Another issue that arises with a simple moving average crossover strategy is that it works average crossover system, helped me with my trading. RenkoScalpSystem is Trading system that using Renko Chart as FX Engine System V3. Trading System; Indicator MACDSMAalertsv3. Download all metatrader 4 Indicators, forex robots, trading systems forex strategies for FREE. The 1 min forex scalping trading system is designed to give you quick and powerful entry and exit signals on the 1 min trading charts. GBPJPY Range Bar Trading System. Trading Systems Most Replied 12H; Forum Block Settings Show Forum. The two most popular types of moving averages are the Simple Moving Average a moving average crossover system will moving average. How to install RSIOMA III Forex Trading System? SMA and 5 RSI Forex Swing Trading Strategy 4 Comments. Inside Bar Pattern Price Action Strategy 3 Comments. Please visit the link The 3SMA TrendRiding System and PLEASE watch the videos to learn about this beautiful system Hector Trader 3SMA Forex Trading System has. Download 3SMA Indicador: Trading Bonus Free 25 No Deposit Required: Forex Trading System 3SMA The First Swing Those who downloaded this book also downloaded the following books: Comments Better System Trader. HYBRID: trading system within a trading system Trading Discussion the modified hector 3sma i get about 1 to 4 per week. Hector Trader System PDF Download Are you at the peak of buying into the Hector Trader System PDF download but a forex trading system that. Download Full Hector Deville Trading 3 SMA system (HDRips) HDRips AVIXviD, 687 kbs 1120x772 Duration: 17 hours English: MP3, 128 kbs (2 ch) 9. Forex Strategy 3ducks very simple and easy to use, like the majority of trading systems it is more productive in situations when prices move in a A Winning Strategy Using Moving Average Average True Range. A Winning Strategy Using Moving Average Average True Range. Spinal muscular atrophy (SMA) makes it difficult for a child to move around, walk, or breathe. Although there is no cure, therapy and other treatments help improve a. When there is no clear trend and you need to either stand aside or switch from a trendfollowing system to a rangetrading 20 period simple moving average. The 20 pips price range moving average strategy is used with the 1 Hour and 15 minute Forex Trading charts. Moving Average Trading System. Trend following is an investment or trading strategy which tries to take advantage of long, (SMA) crosses over the 100 period SMA, go long when the market opens. You are watching Price Action Part 1 Introduction If you can't see the video, try to refresh the page press F5 or notify me at forex gmail. Forex Trading Strategies and Manual Trading Systems Free Strategy and System Trading, Best Forex Trading Strategies Metatrader 4, MT4 Sunny. CO 2 certificate trading) SMAs solution for photovoltaic diesel hybrid 3. Forex Trading System The subject of Forex Trading System is a vital issue. Top 5 Popular Trading Strategies. Company are not indicative of future returns by that trader or system. I have been trying to develop a simple long term trading system by eyeballing the charts and I think I have found something. Check out our stepbystep tutorials of day trading systems, including detailed instructions for each trade and charts of real trades made with trading systems. SMA Daily System is a trend following strategy suitable for any currency pairs. Study Determines The Best Moving Average Crossover Trading death cross since 2011 when the indexs 50day simple moving average Benzinga is a fast. Forex Trading Pro System Technical analysis is the study of market action primarily through the use of charts, to 20 simple moving average resistance 3. Two of the most common types of MA lines are the Simplified Moving Average (SMA) Figure 3: Crossing of MA lines for trading opportunities Figure 4. Simple Versatile Forex Strategy With Heiken Ashi Candlestick. Take advantage of the smoothed Heiken Ashi candlestick with this simple versatile trading strategy. EMA Strategy How To Use Effectively. SMA: A simple, nifty trading system using ema and sma, stock trading 315 strategy, how to. Is TradeSim by Compuvision worth the investment? Find out if your trading system is making money using TradeSim and MetaStock. Most people are better off investing in long term than trading, because of the 3 factors back tested trading system. I am using Simple Moving Average. Improving The Moving Average Crossover System. Lets take a look at a simple moving average crossover system We certainly dont have a trading system. The current article will acquaint you with another reliable trading system based on the combination of a slow SMA Full Stochastic Oscillator and RSI. Anyone out there taking note of the nine and eighteen day Simple Moving Averages with regards to commodities trading? I am currently long in Soybeans. SMA Solar Technology AG Energy That Changes. As a leading global specialist in photovoltaic system technology, SMA is setting the standards today for the. Spinal muscular atrophy of the protein results in loss of function of neuronal cells in the anterior horn of the spinal cord and subsequent systemwide atrophy of. I am going to share with you one of the simplest trading strategies you could ever Simple moving average 200 this system is not a Holy Grail of trading. Building Your Trading System Part 3. Lets build a system around low volatility sideways. Enter and exit trades without conflict or stress. Free Forex Scalping System Every successful forex scalping system MUST have these 3 points. Our TFA Sniper has it, does your system have it. Have A Great Forex Scalping Strategy? Would you like to share a forex scalping strategy. Download Indicators, Forex systems, Expert Advisors, Strategy trading for free. Hi everyone, I created my own system of scalping. This system is very simple, anyone can use it. You can download the article of forex scalping right now. The returns from this forex trading system are as large as the name XXL forex scalping system, and it's not even that complicated Video Download 100 Free Forex Scalping System If you study Forex trading systems, There are some forex scalping indicators that can help traders to create an edge over the market by performing different. The GBPUSD Easy 1 Min Forex Scalping system is designed specifically for use on the GBPUSD pair with the ability to scoop profits on small price changes. Free Forex Systems for Scalping: A Perfect way for Beginners Free Precision Scalping Trading System was developed by the Forex traders. It is an easy to use trading system and developed to trade better 100 Free Forex Scalping Robot Make Money trading Forex every ONE MINUTE totally on Autopilot! There is nothing to buy our free Forex scalping robot is totally. MINUTE SCALPING SYSTEM just open a live account with them and they reward you with free trading why you havent used it from the start of your Forex. The best Forex Trading System and the best Forex Scalping System hello fellow traders! Recommended Forex Scalping System If you like scalping. HUGE COLLECTION of Free Forex Trading Strategies, Trading Systems, Price Action Strategies, Forex Scalping Systems News Trading Strategies, Free signals. The Best Scalping System: Free Forex Strategies, Forex indicators, forex resources and free forex forecast. Forexprofitway is a forex worldzone for best forex mt4 indicators and forex trading system for mt4, forex signals, forex trading strategies and more. Forexprofitway is a forex worldzone for best forex mt4 indicators and forex trading system Download Forex Scalping M1 And M15 Trading Free Download Forex. Looking for the best free forex trading systems? Learn and download systems and strategies that really work for scalping, day trading, swing and position Here you can download best Free Scalping Forex system that really works a strategy based on the principle of a fast opening and closing of positions 15 minute. A timetested Forex Trading System with DOCUMENTED PROOF! Video embeddedDownload new exlusive EA that includes fully automated forex scalping Forex Scalping Strategy System If you have any problems or questions feel free. Trade with the Best Platform for Advanced Traders. A free collection of forex scalping trading systems for Metatrader 4. Explore our growing collection of free easy to trade forex scalping trading systems. Learn how to profit from small currency market movements. Super Fast Forex scalping system for Meta Trader 4 works with any currency pair and its best to be used with the M1, M5 and M15 time frame. Trade the Forex market risk free using our free Forex trading simulator. NEW Academy Forex scalping system strategies can be manual or automated. Free Scalping Indicator indicator for scalping with profitability of 80 Free trading systems and indicators for forex and binary options New Low Pricing. Save Trade Now Huge collection of free forex trading strategies, scalping trading systems, methods, buy and sell signals, Metatrader 4 indicators and many more. Forex Free resources is a collection of free resources for trading: forex strategies, binary options strategies, trading systems, indicators, chart patterns. We got a special gift for you today. It's our Free Forex Scalping MT4 Indicator designed for short term Forex traders. In today's fastmoving markets This is probably one of the best free Forex trading systems, An even more significant feature is that the Hybrid Scalping System manages risk on an excellent level. Forex scalping has gained high popularity nowadays. We welcome you to explore our free and steady growing collection of Forex scalping strategies and ideas. Our Forex Trading Systems and Free Tools can be used with every Broker who supports trading with the very popular Meta Trader platform. Real money performance test of at ForexPeaceArmy. All FPA performance tests are unfiltered, pulled directly from MT4. Video embeddedForex scalping system 2017 is an accurate forex scalping system. Check fro other strategies and trading tools. Automated Forex Scalping Systems Forex Robots. Our goal is Sharing knowledge to help forex traders to do well in the market. Everything here is for free and will. The Super Trend Forex System is a very effective scalping system designed for trading the 1 minute trading charts. Learn and download this scalping system. Free scalping indicator system is a trend following trading system for intraday trading. The author is Karl Dittman Dittman. On line there are various setup of this. Pips Forex Scalping System very accurate trading system for scalping Free trading systems and indicators for forex and binary options Read a comprehensive article and find out how to choose the most suitable Forex scalping trading system for you. Improve your trading with this article now. We have the best forex scalping system utilizing the best forex scalping indicators strategies to truly profit from the TFA Sniper Demo. Free Scalping Trading Indicator Forex Metatrader4. THIS IS A FREE SCALPING INDICATOR THAT: Works on M1 and M5 timeframes; Works on ALL Major pairs. This is how we turned a 500 Portfolio into a Monthly Residual Income THE FOREX SCALPINGScalper TRADING SYSTEM EXPLAINED. The forex moves in trends, forex scalping trading system Start your 7 day free trial Sign up. Scalping systems; Forex systems with MT4 custom indicators; Scalping system# 22 Free ebooks: Currency Index. Save Trade Now Get a forex scalping system 100 FREE Profit and Loss Potential disclaimer In any market where a potential for profit exists, there exists also a risk of loss. Professional Best Forex EA's and Indicators for experts and beginners. Choose form many profitable EA robots to Download. Hedge, Scalping, RSI, and many more We are the group of experienced professional traders specialized in providing accurate daily forex signals based on live trading data and experience. The most powerful forex trading strategies and currency trading systems revealed for both beginners and advanced forex traders. Free Forex Trading Strategies and Trading Systems Related Images 'Free Forex Scalping System' (171 pics): Free Forex Scalping Signals - Best Scalping Systems Trade with the Best Platform for Advanced Traders. Automated Forex Trading System 80 Accurate Forex Scalping System Strategy With MACD And Stochastic Indicator Forex Scalping Strategy System v2. EA Forex Scalping Strategy System v2. EA This time we would like to introduce you with our Forex Scalping Strat Forex Robot 2016:: Scalping EA:: Free Download 5 Build Your forex system, scalping strategy, forex scalping strategy, free forex. Download Indicators, Forex systems, Expert Advisors, Trading Strategies for free. Pips Daily Scalper Forex System Indicator. Best Forex Scalping System Free Scalping Indicator Continuous automatic pivot calculator (Which works on metatrader platforms only). For the range forex calculators. BJF Trading Group is forex software Forex Scalping Robots; MT4MT5JForex Expert Advisor or Forex Robot is a fully automated forex trading system. If Your Forex Scalping Method Did NOT win 21 Out of That simply doesn't leave a lot of free time left to trade forex, great system you have here with. Pips Forex Scalping System is very accurate trading system for scalping, which is intended to trade on the timeframes M5 and M15. RSIOMA Scalping System is a forex trading strategy. RSIOMA strategy is used to scalp in the foreign exchange market. Download it free Scalping Strategy Forex indicator Get here Scalping forex indicator strategy best for M1 and M5 time frame. You can use this Scalping: iforex system any pair but. This time we would like to introduce you with our Forex Scalping Strategy EA. It is new exclusive EA that includes fully automated scalping system Free Contents. Forex Scalping System: 20 assigned downloads, like forex 3 in 1 system, win only pay, money guaranteed from egyptain1970 Trading With Range Bars Simple Forex Scalping System. When scalping your forex market you do this system is a range bar chart. On Forex MT4 EA site, you can find Indicators, Expert Advisors, Scripts, Strategies, where all files are available for FREE and there is NO registration. Learn How To Trade This 1 Minute High Frequency Support And Resistance Forex Scalping System Here with its trading rules. In this post, I will discuss a simple forex scalping system that works well on the M5 and M15 timeframes for me. I prefer to use this forex scalping system on the M15. Forex scalping has gained high popularity nowadays. We welcome you to explore our free and steady growing collection of Forex scalping strategies and ideas. Forex Scalping is a great thing to make fast pips within a short time. Please register free for our forex scalping service to see how we are. Forex Scalping System, Best Scalping Strategy, 1 min scalping system, 5 min scalping system, hybrid scalping system, simple scalping system, scalping techniques Forex Scalping Scalpers Wanted Scalping strategies or systems in FX vary greatly. Take Advantage of our Managed Forex Accounts; Get Free Training and. Forex Strategies Forex Trading SystemScalping SystemForex R. Samsung is among the few manufacturers out there who consistently place capacitive buttons under the screens of their devices. While other smartphone builders prefer to rely on the virtual navigation buttons, present on stock Android, Sammy and co's decision to place hardware keys allow for larger screen real estate and a lot of users prefer them. The buttons haven't changed much since inception – they are LED-backlit, for ease of use, and give off a vibration feedback when tapped, so that the user can be sure that the input has been registered. The battery saving mode that Samsung has been placing in its TouchWiz interface for more than a year now turns off the backlight and vibration feedback automatically, to conserve the most power possible. But you yourself can limit those manually. We've already looked at how you can, here's how to enable / disable the vibration of the capacitive navigation keys on the,. Global mRNA abundance depends on the balance of synthesis and decay of a population of mRNAs. To account for this balance during activation of T cells, we used metabolic labeling to quantify the contributions of RNA transcription and decay over a 4 h time course during activation of leukemia-derived Jurkat T cells. While prior studies suggested more than half of the changes in mRNA abundance were due to RNA stability, we found a smaller but more interesting population of mRNAs changed stability. These mRNAs clustered into functionally related subpopulations that included replicative histones, ribosomal biogenesis and cell motility functions. We then applied a novel analysis based on integrating global protein-RNA binding with concurrent changes in RNA stability at specific time points following activation. This analysis demonstrated robust stabilization of mRNAs by the HuR RNA-binding protein 4 h after activation. Our unexpected findings demonstrate that the temporal regulation of mRNA stability coordinates vital cellular pathways and is in part controlled by the HuR RNA binding protein in Jurkat T cells following activation. INTRODUCTION Two major processes in the cell determine the abundance of each mRNA: the rate of its transcription and the rate of its decay. The temporal regulation of these two processes enables global changes in gene expression that drive dynamic cellular responses. For example, in the immune system, T cell responses following activation are driven by the rapid induction of cytokines and chemokines involving both transcriptional and post-transcriptional regulation (–). Tight temporal control of expression of these immunoregulatory genes is crucial in order to strike the balance between an immune response that is sufficient to clear an infection yet restrained enough to prevent inflammatory damage. Indeed, control of inflammatory gene expression is increasingly recognized to include global regulation of mRNA decay in T cells. For example, many studies have described the importance of post-transcriptional regulation of cytokines and chemokines that cause major cellular changes in growth, proliferation, differentiation and metabolism (–). But in most of these cases, the role of post-transcriptional regulation is unclear. Two distinct approaches have been used to globally assess the involvement of post-transcriptional regulation in activating T cells (,). One study compared nuclear run-on assays with total mRNA in the first hour of Jurkat T cell activation and extrapolated that more than one-half of the expressed genes were changed, primarily by mRNA decay (). An earlier study using transcriptional inhibition of primary human T cells over a 2 h period of activation by co-stimulation identified substantially less regulation by mRNA decay (). The former study utilized invasive cellular methods that disrupted cell metabolism in addition to binary definitions of change, while the latter only resolved changes for very short-lived mRNAs and could not address transcription-dependent regulation. Therefore, the behavior of and relationship between transcriptional and post-transcriptional contributions to global gene expression changes during T cell activation require further examination. Recently, methods have been developed that quantitate transcription and stability rates simultaneously using pulsed nucleotide analogues such as 4-thiouridine (4sU) (–). This nucleotide analog is efficiently incorporated into nascent mRNAs without perturbing cell metabolism (). This method uses the analysis of the relationships between total, labeled and unlabeled mRNAs to accurately measure stability, even for stable mRNAs (). Furthermore, this approach has been effectively used to quantify mRNA synthesis and decay rates during dynamic changes in gene expression (,,). In recent studies, we used 4sU metabolic labeling to assess the transcription and stability in CD8 + T cells responding to HIV antigens (), and in a model of Hepatitis C virus infection (). Therefore, 4sU metabolic labeling is an established quantitative procedure that is capable of measuring dynamic changes in both transcription and decay during T cell activation. Moreover, metabolic labeling can serve as a useful platform to quantify how changes in RNA stability correspond with mRNA targeting by specific RNA-binding proteins. In a previous study, we reported that HuR, an RNA binding protein (RBP) known to stabilize certain mRNAs, substantially changed its RNA targets following Jurkat T cell activation (). At each time point post-activation, HuR maintained its well-studied preference for binding to U-rich mRNAs (–). Groups of these U-rich mRNAs, however, changed in their binding with HuR after activation. These changes were concentrated in functionally related groups of mRNAs that encoded cell cycle, mRNA processing and Wnt signaling proteins (). A change in RBP binding, however, does not necessarily lead to a change in stability or regulation. In fact, many RBP targeting experiments have clearly shown that RBPs bind some mRNAs that are not regulated. And previous approaches to understanding the impact of RBP binding have typically used measurements of mRNA abundance of the targeted mRNAs after disruption of RBP expression to indicate potential regulatory events at RBP binding sites (,,). Cricket Cell Phone plans allow users to subscribe to monthly service plans without long-term contracts. Obtaining an activation code for a Cricket cell phone is quick. Measuring global mRNA decay rates, however, can more directly measure the impact of changes in HuR binding on RNA abundance. Therefore, we quantified changes in mRNA stability during early Jurkat T cell activation, and integrated these changes with data from HuR binding to investigate how HuR affects the stability of its mRNA targets. To this end, we utilized 4sU metabolic labeling to quantify the dynamics of transcription and decay over a 4 h time course using the Jurkat T cell activation model. We characterized the global transcriptional and post-transcriptional regulatory dynamics and matched the relationships in stability changes with HuR targeting specificity. Contrary to previous reports, we found that a relatively small, but functionally important proportion of activated Jurkat gene regulation depends on changes in mRNA decay. Importantly, these post-transcriptional changes included mRNAs that encode crucial aspects of cellular signaling, replication, protein production, growth and migration. Furthermore, by integrating global RNA stability data with RBP targeting data, we showed that HuR stabilizes condition-specific mRNA targets after activation. 4-thiouridine (4sU) labeling 4sU metabolic labeling was performed as outlined in () with minor modifications. Brieftly, 200 μg/ml 4-thiouridine was added to the culture 1 h prior to each harvest time point. Cells were lysed in Trizol (Life Technologies) and RNA was extracted using manufacturers recommendations. 4sU labeled and unlabeled RNAs were separated as described in (,). Streptavidin MyOne C1 conjugated dynabeads (Invitrogen) were used to bind and select biotinylated RNA. Isolated RNA was prepared for either real time polymerase chain reaction (PCR) using iScript cDNA synthesis kit (Bio-Rad) or prepared for deep sequencing using ScriptSeq RNAseq kit (Illumina). Deep sequencing & data analysis Sample libraries were sequenced using an Illumina Hi-Seq 2000 using 50 bp single end settings. Data were mapped using TopHat2 (), raw counts calculated with HTSeq () then counts per million were calculated and normalized for total mRNA and labeled mRNA independently using edgeR (). From three biological replicates, genes with 50% standard error at any time point or condition were removed. Subsequently, levels of 4sU incorporation were determined as previously reported (), observed to be approximately 1 in every 125 uridine bases (data not shown), and accounted for in net transcription levels. Changes in mRNA abundance and net transcription at each time point were calculated relative to unactivated Jurkat cells using edgeR based on a false discovery rate (FDR) of.01. Additionally, a T score continuous metric was calculated for both net transcription and total mRNA abundance. Subsequently, iterative transcription-based modeling calculations were optimized using a linear regression model to maximize absolute correlation between predicted and observed values. This calculation concluded that a coefficient of 0.266 optimally related net transcription abundances to total mRNA abundances. Decay rates were determined using the iterative formula outlined in Figure using observed mRNA abundances and net transcription. For the unactivated time point, because of steady state mRNA levels at rest, this equation simplified to ln(1.266*(net txn/total)). Significantly different decay rates at any time point were calculated in R using one-way ANOVA and an FDR of 0.1. Subsequently, T scores comparing decay rate at each time point to unactivated decay rates were calculated. These T scores were used as a continuous metric as inputs into Short Time-series Expression Miner (STEM) () and for integration with binding data. Actinomycin D labeling and real time PCR Cells were labeled with 5 μg/ml actinomycin D for a fixed period of time as described in (). RNA was isolated and cDNA generated using iScript (Bio-Rad). Platinum SYBR Green Super Mix (Invitrogen) was used for real time PCR on a Lightcycler (Roche). Raw Ct values were normalized to GAPDH Ct values and resting Jurkat cells. These ΔΔCt values were analyzed using GraphPad Prism where half-lives were calculated based on one phase decay and statistical significance was determined using one-way ANOVA. RESULTS We evaluated gene expression changes in Jurkat T cells by quantifying mRNA levels following the addition of activating mitogenic compounds phorbol myristate acetate (PMA) and phytohemagglutinin (PHA). In order to simultaneously measure changes in RNA abundance, transcription and stability across the transcriptome in this activation model, we used 4sU metabolic labeling (). Prior to activation, and during each of 4 h after activation, we pulsed 4sU into cells for 1 h. The 4sU was incorporated into nascent RNAs (Figure ), then the RNA was extracted and labeled RNA was separated from unlabeled RNA (Figure ). Total mRNA and 4sU labeled mRNA from each 1 h interval were sequenced for three biological replicates. After mapping the RNA-seq data to the genome, the mapped RNA-seq reads were characterized according to their genomic origin. 4sU labeled mRNA contained substantially more intronic reads than total mRNA (Figure ), indicating an enrichment of pre-mRNA that demonstrated that the approach captured recently transcribed mRNAs. Having validated the methodology, we measured mRNA levels of each sample using HTSeq-count () followed by edgeR normalization () and removed genes with low expression or high variation between replicates. We observed significant changes in mRNA abundance and/or 4sU labeled mRNA in 1747 genes across the first 4 h after stimulation. These changes clustered into similar functional groups in both the mRNA abundance and 4sU labeled mRNA (Figure ). The earliest responding messages, during the first hour, encoded apoptotic and transcriptional factors. In the second hour, the list grew to include additional transcription-related factors. Finally, in the last 2 h, many mRNAs encoding cell maturation and immune response factors were regulated. Interestingly, several of these same functional groups were enriched in the 4sU labeled mRNA population earlier than in total mRNA, reflecting the greater sensitivity obtained by measuring net transcription rather than total mRNA abundance (Figure ). 4sU metabolic labeling measures transcription and mRNA abundance during Jurkat T cell activation. ( A) Experimental design. 4-thiouridine (4sU) was pulsed for 1 h for each of the first 4 h after addition of PMA and PHA to Jurkat T cells. Cells were harvested. The advantage of a metabolic labeling approach is the ability to assign proportional changes in mRNA abundance to transcription and decay. To investigate this relationship, we started with the simple equation that mRNA abundance equals previous abundance, plus net transcription, minus the amount of decay (Figure ). Utilizing a model based off of ‘Dynamic Transcriptome Analysis’ (), we calculated the unactivated decay rate and assumed it remained constant throughout the time course. Assuming constant decay, we could estimate the abundance at 4 h using only the unactivated mRNA abundance and the 4sU labeled mRNA abundance for each hour (Figure ). This transcription-only model estimated the abundances of regulated mRNAs well; genes that changed more than 2-fold in abundance at any point in the experiment correlated well ( R = 0.945) with the observed abundances relative to the baseline of unactivated abundances ( R = 0.691) (Figure,). The increase in predictive power using net transcription demonstrates that transcription accounts for approximately 80–85% of the changes in mRNA abundance observed (Figure ). This calculation agreed reasonably well with a simple correlation of mRNA abundance and net transcription at each hourly interval ( R = ≈0.75–0.8 across all time points, data not shown). Overall, this suggested transcription was the major driver of changes in mRNA abundance. On the other hand, the remaining ≈15–20% of genes were poorly explained by this model that assumed constant mRNA decay. Two clear examples were RNF145 (Figure ) and DDX3X (Figure ). When the time course of observed mRNA abundance (blue line) was plotted against the estimated mRNA abundance (dashed line), the mRNA abundance changed more dramatically than the transcriptional changes (red line) would predict in many cases. This finding suggests that these genes are regulated post-transcriptionally, with RNF145 mRNA less stable and DDX3X mRNA more stable after activation. We confirmed these predictions using real time PCR measurements of both 4sU metabolic labeling (data not shown) and transcriptional inhibition at different times after activation. When Actinomycin D was added at any point after activation, RNF145 mRNA decayed more rapidly and DDX3X mRNA decayed less rapidly than prior to activation (Figure, ). Changes in mRNA abundance of many mRNA messages are not due to transcription alone. Two prime examples of mRNAs whose transcriptional changes do not explain their mRNA abundance changes are the downregulated ( A) RNF145 and upregulated ( B) DDX3X. Therefore, to identify all the genes that undergo quantitative changes in mRNA decay, we used the observed values of mRNA abundance and net transcription to solve the model relating transcription and decay for the decay rate. These values represent the decay rate necessary to balance the observed net transcription and mRNA abundance at each time point. Using the variance between replicates, we then calculated T scores for changes in decay rate relative to unactivated cells over the first 4 h of activation. Of the 1747 mRNAs that were regulated after activation, 425 of them had significantly altered decay rates at some point after activation based on a false discovery rate of 0.1. We confirmed decay rates changes using independent methods in several genes that represented a spectrum of direction and magnitude of decay rate regulation observed. These mRNAs measured by global 4sU RNA-seq and real time PCR after transcriptional inhibition were largely consistent (data not shown). To explore the role of mRNA decay in Jurkat T cell activation, we used the decay rate T scores to evaluate the temporal dynamics of post-transcriptional regulation. Decay rate T scores were clustered into regulatory patterns using Short Time-series Expression Miner (STEM) (). Three of the clusters were particularly striking in their functional relationships, suggesting coordinated post-transcriptional regulation (,) (Figure ). The first cluster consisted of a set of mRNAs stabilized in the first hour after activation. This subset of mRNAs was enriched for RNA regulatory factors, namely for the production of ribosomes (Figure ). Increased ribosome production would be a sensible early step to prepare for the additional translation required for growth. The third cluster was enriched for a set of mRNAs encoding factors related to cell migration and motility (Figure ). The migration of T cells is a crucial step after activation in order to spread the immune response out of the lymphatic tissue and into the areas of primary infection (). Therefore, these cell migration and motility mRNAs appear to have been stabilized during the later wave of T cell activation to promote and support this increase in cellular movement. Coordinated changes in mRNA decay involve functionally related protein products. ( A) The dynamic changes in three clusters in decay rate T score after activation are examples that are characteristic of post-transcriptional RNA operons and regulons. The most enriched cluster of mRNAs, however, was strongly destabilized at 1 h, then rapidly stabilized at 2 h post-activation. This cluster was highly enriched for histone mRNAs; 28 replication dependent histones were contained in this cluster. A compilation of the decay rate T scores of all expressed replication dependent histones demonstrated that nearly all followed a similar pattern of regulation (Figure ). We evaluated this observation by real time PCR. Because the dynamics of this regulation occurred so rapidly, we assessed post-transcriptional events in 15 min intervals after activation by both 4sU metabolic labeling (data not shown) and Actinomycin D transcriptional inhibition. With higher temporal resolution, we observed a decrease in the stability of HIST1H2AB, HIST1H2BG, HIST1H1B and HIST1H4D immediately upon activation (Figure –). This destabilization recovered starting at 30 min and was not dependent on transcription. Histone mRNAs are a highly unique class as they are the only mRNAs that are not polyadenylated (,). Their expression is tightly controlled and they are only upregulated, through both transcriptional and post-transcriptional mechanisms, in S phase (). Their coordinated regulation is one of the clearest examples of a post-transcriptional regulon discovered to date (,). The major protein that coordinates histone mRNA stability is the stem loop binding protein (SLBP), via binding to a stem loop that is only found in the 3′ UTR of histone mRNAs (,). Therefore, we examined SLBP protein levels after T cell activation and observed that after 1 h of activation, SLBP protein was significantly decreased (Figure ), consistent with the decrease in stability of histone mRNAs. Interestingly, however, while SLBP protein abundance recovered somewhat in the second hour, it did not increase above baseline as histone mRNA stability did. Overall, the coordinated responses of several different crucial groups of mRNAs at the post-transcriptional level indicate that changes in decay rate play an important role in regulating mRNAs following the activation of Jurkat cells. Histone mRNA regulation after Jurkat cell activation. ( A) Change in T scores of mRNA stability of each individual replication dependent histone mRNA (light blue) over the entire 4 h time course from three biological replicates. Dark blue line represents. Having calculated both changes in transcription and changes in decay, we explored the relationship between the two processes in Jurkat T cell dynamics. Selecting mRNAs with significantly altered abundance at each time point, we plotted the change in transcription against the change in mRNA stability (Figure –). Across the time course, we observed that transcription and stability cooperate to maximize regulatory potential. Relatively few genes were transcriptionally increased and destabilized, or vice versa, as shown by the relative lack of mRNAs in the upper left or lower right quadrants of each time point. This suggests that transcription and stability cooperate to minimize counterproductive regulatory changes, thereby maximizing the speed and efficiency of T cell responses. Changes in stability and transcription cooperate to maximize changes in mRNA abundance during Jurkat T cell activation. (A-D) Among genes that reproducibly changed in total mRNA abundance at ( A) 1 h, ( B) 2 h, ( C) 3 h and ( D) 4 h, the log fold change in. Finally, previous studies have not integrated global mRNA stability data with RBP target data to examine the relationship between binding and regulation. However, we previously demonstrated that mRNA targets of HuR, a well-characterized promoter of mRNA stability, change significantly after Jurkat activation (). Therefore, we analyzed the changes in mRNA stability after 4 h of activation in three different categories of mRNAs: targets of HuR at 4 h of Jurkat activation, targets of HuR in Jurkat cells but not at 4 h after activation, and non-HuR targets. We observed a significant stabilization of mRNAs bound by HuR at 4 h after activation that was not true of non-targets or non-four hour HuR targets (Figure, left of dashed line). The integration of HuR binding data suggests that binding of HuR to mRNAs after activation strongly influences the stability of those messages. Changes in regulation are most closely correlated with effects of HuR mRNA binding when RNA binding is defined under identical conditions. (Left of Dashed Line) HuR mRNA binding correlates with increases in stability. HuR targets were previously identified. Given that we saw a significant difference in stabilization based on the HuR-binding state of mRNAs, we wondered how experiments that previously defined HuR targets using different cell types would relate to mRNA stability in Jurkat activation. Thus, we identified HuR mRNA targets defined in previous studies encompassing several different cell lines and techniques, including RIP-chip, PAR-CLIP and iCLIP (,,). We assessed the changes in the stability of these mRNA targets at 4 h after activation (Figure ). The mRNA targets of HuR identified in each of the published mapping experiments was significantly stabilized relative to non-targets, but nonetheless were significantly less stabilized than the targets identified in Jurkat cells at 4 h. Therefore, while targets identified using HuR RIP or CLIP experiments in different cell types indicated a relationship between HuR binding targets and regulation of stability, the strongest relationships were apparent when both the HuR RNA targets and the global stability changes were determined under identical conditions. DISCUSSION Our data indicate that Jurkat cells undergo substantial transcriptional and post-transcriptional regulatory dynamics following activation that coordinately influences the abundance of important functional groups of mRNAs. Using this dynamic model system, we found that both mRNA transcription and stability cooperate to maximize the efficiency of regulation. Moreover, the responses to HuR binding under identical conditions in these cells suggests a potential cause and effect relationship leading to the stabilization of specific mRNAs encoding proteins important to Jurkat cell activation. We found that the regulation of mRNA stability occurs among functionally related groups, the core of the post-transcriptional regulon hypothesis previously proposed from our group (). Interestingly, this regulation occurred in functional groups that are crucial to major cellular processes such as cell replication, protein translation and cellular movement. This expands greatly on the previously established immune regulatory factors studied in the context of T cell activation. Post-transcriptional events are important for tuning or ‘fine tuning’ the expression of these genes to meet cell requirements, an observation previously noted (). One of these vital functional groups found to be quite robust is the histone mRNAs, a classical post-transcriptional regulon () (Figure ). Histone mRNAs require coordinated regulation to promote cell replication, and therefore contain similar sequences and structural characteristics to engage binding by a common Stem-Loop Binding Protein, SLBP, that controls its export, stabilization and translation (). The stability of histone mRNAs is tightly coupled to DNA replication and S phase (), thus, a pause in Jurkat cellular replication may occur through a signaling cascade immediately upon mitogenic stimulation. Since activation is to some extent a proliferative process, the response could be rapidly reversed in the second hour to drive the production of histones. The decrease in SLBP protein during the first hour, as shown in Figure, supports this model. During the second hour, however, histone mRNAs are more stabilized than the recovering abundance of SLBP appears to indicate. This potentially hints that another mechanism may contribute to histone stabilization. This mechanism may include SLBP phosphorylation, localization or binding by another RBP factor. Overall, however, these histone mRNAs exemplify the coordinated regulation of mRNA stability by RBPs in this system. Similar published examples of tight coupling between RBP binding and functional RNA regulation have been relatively sparse in this era of global targeting studies of RBPs. However, we demonstrate another example of tight coupling in this study. We integrated our direct calculations of mRNA stability with the targeting of HuR from replicated RIP experiments under the identical conditions (). We observed strong functional correlations with targets bound to HuR at the same time point. In fact, the data suggest binding by HuR imparts ≈25% greater stability, on average, for these specific targets (Figure ). Importantly, we did not find that HuR mRNA targets identified in Jurkat cells at time points other than 4 h were significantly stabilized. These regulatory dynamics in HuR occurred despite no change in protein abundance (unpublished observations) or localization (). It is likely post-translational modifications such as phosphorylation play a role in these regulatory dynamics, as has been shown for HuR in other cell models (,). Additionally, we were able to integrate other published HuR target data sets from other cell types using a variety of methods, including RIP, iCLIP and PAR-CLIP studies, none of which involved T cell activation. Each technique defined a set of targets that, while U-rich, varied in number and composition of their genes of origin. For example, previous studies using HEK293 cells have shown that genes that overlap between multiple technical approaches have the strongest functional relationship under HuR knockdown (). However, data in this study further show that cellular context is very important in interpreting the relationship between binding and function. In other words, the best correlation between global binding and regulation occurred when using identical temporal and biological conditions. Previous studies have emphasized a larger and wide-spread role of post-transcriptional regulation in T cell activation systems than we observed (,,). One major factor may be the T cell type used; indeed, other reports have indicated differences in global RNA stability between primary T cells and malignant T cell lines (). It is unclear, however, whether the discrepancies between this study and other is primarily because of differences in cell type (Jurkat T cells versus primary T cells), time course studied or methodological approaches. One previous study utilizing the same Jurkat T cells with chemical activation reported a much broader influence of post-transcriptional regulation than we observe even though a shorter time frame was used (). In this case, methodological differences seem to underlie much of this discrepancy. First, the array technology used did not include genes we found important such histones. Second, ‘newly transcribed’ RNA was isolated using a nuclear run-on assay, a cell invasive method that strips the cell of its native context. Furthermore, post-transcriptional changes were defined as varying between nuclear run-on and total mRNA. The 4sU metabolic labeling approach is advantageous in that cells remain unperturbed until RNA harvest and modeling of the interaction between transcribed and total mRNA discerns post-transcriptional differences with high sensitivity. Additional studies have measured decay of mRNA with inhibition of transcription (). One major difference in analyzing transcriptional inhibition and metabolic labeling-based approaches as we have done here is that metabolic labeling is retrospective while transcriptional inhibition is prospective. For example, a 1 h time point in 4sU metabolic labeling measures transcription during the first hour of activation, while inhibiting transcription at 1 h measures the decay of mRNAs present over the following 2–4 h. This can lead to major differences among mRNAs in which decay rate varies over these intervals. For these reasons, clear switches in decay rate, such as we observed for RNF145 and DDX3X, represent the most consistent examples of post-transcriptional regulation (Figure, Supplementary Table S1). We observed several other examples of transient changes in RNA decay rate using 4sU metabolic labeling that were more difficult to replicate through inhibition of transcription, including the rapid transitions observed in histone mRNAs (Figure, Supplementary Table S1 and data not shown). These discrepancies may also result from the possibility that post-transcriptional events depend on the transcriptional induction of post-transcriptional factors such as RBPs or miRNAs (). There are several important caveats to consider when interpreting data using the 4sU metabolic labeling that are consistent with our study being conservative in defining post-transcriptional regulation. First, it is important to recognize that some labeled RNA decays over the 1 h period of labeling. As such, the true transcription rate requires a correction for decay, which is the reason labeled mRNA is carefully termed ‘net transcription’. This fact can bias results slightly toward favoring changes in transcription rate over RNA stability changes, and is overall conservative for attribution of gene expression changes to mRNA stability. For example, the moderate decline in net transcription in RNF145 (Figure ) may be, in part, a result of the increased decay rate. However, this is not likely to be a large factor in our global analysis demonstrating cooperation between transcription and decay for two reasons: first, the effect is modest, and second, previous studies in yeast using the same 4sU metabolic labeling approach identified the opposite phenomenon in osmotic shock (). One biological rationale for these contrasting relationships between transcription and decay, other than a major species difference, may be that osmotic shock is a transient cellular stress while mitogenic stimulation of Jurkat cells causes a permanent developmental change in cellular growth, behavior and morphology. Additionally, analysis of 4sU metabolic labeling requires accurate measurement of gene expression, and therefore, we have omitted genes that varied substantially between replicates. The major reason for this variation was low expression at any of the time points. As expected, this included many highly induced genes and immunoreactive genes with low baseline expression that have been the focus of many prior candidate studies of post-transcriptional regulation (–). Indeed, highly inducible mRNAs have been identified as a class that are subject to dynamic regulation of mRNA stability (). Furthermore, differences in decay rates between genes have long been understood to affect regulatory dynamics, because the rate with which gene expression can change depends on how rapidly the mRNA is turned over (). Thus, we would expect that the most highly inducible genes are the most likely to undergo post-transcriptional regulation. However, because of low expression prior to their induction, we were unable to draw conclusions about their post-transcriptional regulation during Jurkat activation. A candidate approach is likely the best way to characterize these genes, as has already been done in many cases (–). This study focused on describing one aspect of the post-transcriptional regulatory code, the regulation of mRNA stability by RBPs or combinations of RBPs. We observed the coordinated post-transcriptional regulation of functional groups crucial to the activation process. The post-transcriptional regulon model hypothesizes different combinations of RBPs and noncoding RNAs regulate these distinct functional groups. In this study, we highlighted one RBP, HuR, that significantly correlated with stabilization of mRNA. Undoubtedly, activation of Jurkat cells is a highly complex process that involves regulation by many different RBPs. Indeed, our evidence suggests that a number of other RBPs must be involved in mRNA stabilization in activated Jurkat cells, as HuR interacted with a minority of mRNAs that were significantly stabilized (31 of 143 comparable genes). Extrapolating more broadly, most other post-transcriptional processes such as destabilization, splicing, export and translation are likewise regulated by combinations of multiple RBPs. Our experimental design in this study is an appealing approach with which to discover the novel involvement of RBPs in a given system, i.e. Correlation of the RBP's targets with measurement of global post-transcriptional responses of mRNAs. By cross-referencing a database of RBPs and their targets to post-transcriptional regulatory changes such as RNA stability, one could imagine identifying RBP candidates with strong correlations to specific regulatory processes. We showed in this study that in the case of HuR, RBP binding significantly correlates with mRNA stabilization across a variety of techniques to identify bound mRNAs. Importantly, and not unexpectedly, we also showed that by a significant margin, the strongest correlation occurs with targets identified at identical time points. When we attempted to predict novel stability regulation by RBPs using published RIP, CLIP and PAR-CLIP data that were obtained under differing biological cell types or conditions, we obtained inconclusive results (data not shown). One observation from this effort was that the inability to meaningfully stratify RBP target data using CLIP and PAR-CLIP hindered the approach, suggesting that quantitative measurements that stratify binding sites may improve these comparisons. Ultimately, however, it is not at all surprising that the relationship between binding and functional regulation was strongest under identical cellular conditions. Therefore, with current techniques, it is difficult to reach meaningful biological conclusions by integrating post-transcriptional data from different cellular conditions. While this potentially limits the application of the experimental design demonstrated in this study as a discovery tool, on the contrary, this approach is highly advantageous for quantifying the impact of specific candidate RBPs in dynamic systems. Abstract Deregulated gene expression in B cells often results in various lymphoid malignancies and immune deficiencies. Therefore, understanding signal-induced gene regulatory pathways involved during B cell activation is important to tackle pathologies associated with altered B cell function. Primary response genes (PRGs) are rapidly induced upon signaling in B cells and other cell types and often encode oncogenic transcription factors, which are associated with various malignancies. However, an important issue that remains unclear is whether the fundamental mechanism of activation of these genes is essentially the same under such diverse conditions. C- fos is a PRG that is induced rapidly upon activation of B cells in response to a wide variety of stimuli. Using the c- fos gene as a candidate PRG, we addressed here how it is regulated in response to tumor-promoting and antigen-mimicking signals. Our results show that although the mRNA was induced and extinguished within minutes in response to both signals, surprisingly, apparently full-length unspliced pre-mRNA persisted for several hours in both cases. However, although the mitogenic signal resulted in a more sustained mRNA response that persisted for 4 h, antigenic signaling resulted in a more robust but very transient response that lasted for. Introduction B cells are essential components of our immune system, and they respond to various cell extrinsic signals to mount an immune response. However, stimulation through different receptors will result in engagement of different signaling pathways and subsequently will result in qualitative differences in programs that initiate the proliferative process (). As proliferation will have profound effects on the regulation of B cell differentiation, survival, and pathologies, strong regulation at multiple points is necessary for proper B cell function (, ). B cells mature in multiple stages, and signaling via the B cell receptor (BCR) dictates B cell fate depending on the particular stage of maturation. Thus, BCR signaling in immature B cells results in cell death, whereas BCR signaling in mature B cells results in survival and proliferation of these cells (). Moreover, mature B cells respond differently to transient versus sustained BCR signaling (). Interestingly, although the early kinetics (1–2 h) of expression of most primary response genes (PRGs) are very similar in both transient and sustained signaling, some of the PRGs are expressed for an extended period (6–9 h) only after sustained signaling (). Taken together, these results suggest that both the duration of signaling and the cell-type context are important for biological responses and that the levels of expression of PRGs might have distinct effects in determining these responses (). The stimulation of mature B cells by both anti-IgM (BCR signaling) and the addition of the mitogenic agent phorbol 12-myristate 13-acetate together with the ionophore ionomycin (P+I) promotes transition from the resting G 0 state into the G 1 phase of the cell cycle (). These changes are associated with de novo protein synthesis-independent rapid induction of PRGs, which include c- myc, c- fos, egr-1, egr-2, and junB, and have been found to play a role in B cell proliferation (). For example, regulated expression of c- myc is associated with stage-specific B cell proliferation (). B cells activated by anti-IgM also transiently express the c- fos mRNA within 0.5 h and then enter into S phase of the cell cycle within 4–8 h (). However, the mechanisms of such rapid transcriptional induction in B cells are unknown. Most information regarding c- fos regulation has been obtained in fibroblasts. Transcription of the c- fos mRNA peaks within 15–30 min after the addition of fresh serum or growth factor to the culture medium and then declines abruptly, returning to initial low levels by ∼60 min (). Although these events take place long before DNA synthesis and changes in nucleosome structure during nucleosome assembly at the replication fork, it is a challenge to understand both the basal and induced chromatin status of this gene (, ). Given that induction of c- fos plays a critical role in driving signal-induced B cell proliferation, we sought to study its transcriptional and epigenetic regulation in response to anti-IgM and P+I stimulation using a mature murine B cell line as a model system. Although both signals regulate c- fos expression in similar ways, there are differences in c- fos expression in response to these signals particularly in terms of unspliced pre-RNA generation. In addition, we show that another PRG, egr-2, is regulated in a similar fashion as c- fos, whereas c- myc is not. Our results reveal an unexpected regulatory step of PRG expression at the level of primary transcription. Cells and Induction The mature mouse B cell lymphoma BAL17 was cultured in RPMI medium with HEPES (Invitrogen) supplemented with 100 units/ml penicillin, 100 μg/ml streptomycin, 1 m m sodium pyruvate, 0.5 m m 2-mercaptoethanol solution (all Invitrogen) and 10% fetal calf sera (Atlanta Biologicals). 1–2 × 10 6 cells were used for RNA-based assays, and 2 × 10 7 cells were used for ChIP. 10 ng/ml phorbol 12-myristate 13-acetate (Sigma) and 150 n m ionomycin (Sigma) were added to cell medium for P+I induction of transcription. For BCR induction, goat IgG Fab fragments specific for mouse IgM (Jackson ImmunoResearch Laboratories) were added at 10 μg/ml to cells for various times. 5,6-Dichloro-1-β- d-ribofuranosyl-1 H-benzimidazole (DRB; Sigma) was used at 100 μ m for 10 min prior to stimulation. Meayamycin () was incubated with cells at a concentration of 10 n m for 30 min prior to cell stimulation. Mouse primary splenic cells were isolated from 8-week-old C57BL/6 male mice (The Jackson Laboratory) following normal procedures. Resting B cells were isolated by labeling splenocytes with antibody against the activation marker CD43 (Miltenyi) and isolating the negative population (CD43 −) as resting B cells following the manufacturer's protocol. The cells were incubated on ice for 30 min with or without ligands, 25 μg/ml Salmonella typhimurium typhi LPS (Sigma) or 10 μg/ml goat IgG Fab fragments specific for mouse IgM, before incubation at 37 °C and 5% CO 2 for the times indicated. Quantitative Real-time PCR RNA was isolated with the Ambion® PureLink RNA mini kit (Invitrogen), followed by digestion with DNase I (Ambion) and purification with a secondary PureLink RNA column. Random primers and reverse transcriptase (Applied Biosystems) were employed to produce cDNA, which was then digested with RNase (Sigma). Samples were diluted in SYBR Green solution (Applied Biosystems) following the manufacturer's instructions. Primers were kept at 900 n m, and samples were run in triplicate with a thermal profile of 95 °C for 10 min and 40 cycles of 95 °C for 15 s and 60 °C for 45 s with the recommended thermal dissociation curve provided by the Applied Biosystems 7300 real-time PCR system. The RT-PCR signals were monitored for consistent dissociation curves and temperatures. All analyses were performed in triplicate. The following primers were used: c- fos mRNA, GGATTTGACTGGAGGTCTG and TGGGCTCAGGGTCGTTGA; c- myc mRNA, TCTCCACTCACCAGCACAACTACG and ATCTGCTTCAGGACCCT; egr-2 mRNA, ATCCTGCGACCTCGAAAGTA and TCAGAGCGTGAGAACCTCCT; and β-actin mRNA, CCTCTATGCCAACACAGTGCGTGCTA and GGAGCCAGAGCAG. ChIP To prepare chromatin, 2 × 10 7 BAL17 cells were washed twice with PBS and chromatin cross-linked by 1% formaldehyde exposure, followed by the addition of 0.125 m glycine to stop cross-linking. Cells were then washed twice with 10 ml of cold PBS and stored at −80 °C for subsequent processing. For processing, cell pellets were resuspended in 1 ml of ice-cold cell lysis buffer (5 m m PIPES (pH 8.0), 85 m m KCl, and 0.5% Nonidet P-40) supplemented with protease inhibitor mixture (Sigma). After centrifugation, the remaining nuclei were resuspended in 200 μl of ice-cold nuclear lysis buffer (50 m m Tris-Cl (pH 8.1), 10 m m EDTA, and 1% SDS) supplemented with protease inhibitor mixture. After a short incubation on ice, the sample volume was increased to 500 μl with ChIP dilution buffer (1% Triton X-100, 2 m m EDTA, 150 m m NaCl, and 20 m m Tris-HCl (pH 8.1)) supplemented with protease inhibitor mixture. Chromatin was sonicated with a Branson 350 Sonifier at a continuous setting of 2 for 10 cycles of 20 s each. After centrifugation, chromatin was precleared with protein A-Agarose (Santa Cruz Biotechnology), and the samples were diluted to 2 ml with ChIP dilution buffer and incubated overnight at 4 °C with protein A-agarose prelinked to various antibodies (see below). Thereafter, chromatin-agarose was washed with 1 ml of cold buffer containing 0.1% SDS, 1% Triton X-100, 2 m m EDTA, 20 m m Tris-Cl (pH 8), and 150 m m NaCl; with 1 ml of cold buffer containing 0.1% SDS, 1% Triton X-100, 2 m m EDTA, 20 m m Tris-Cl (pH 8), and 500 m m NaCl; with 1 ml of cold radioimmune precipitation assay buffer containing 50 m m HEPES (pH 7.6), 1 m m EDTA, 0.7% sodium deoxycholate, 1% Nonidet P-40, and 0.5 m LiCl; and twice with Tris/EDTA (pH 7.5). Chromatin was then eluted with 100 μl 1% SDS and 0.1 m NaHCO 3 for 30 min at room temperature. Eluted chromatin and input DNA (5% of the pre-immunoprecipitation sample) were incubated for 15 h at 65 °C. DNA was purified using PureLink PCR purification kits (Invitrogen), treated with RNase mixture (Sigma), and quantified with the Qubit dsDNA HS system (Invitrogen). Samples were then analyzed by real-time PCR as described above. Signal-induced mRNA Production To analyze the signal-specific induction kinetics of c- fos mRNA in the BAL17 B cell line, we stimulated these cells either with P+I ( A) or with anti-IgM (BCR) ( B). In both experiments, the basal levels of c- fos mRNA were insignificant without induction (). However, as noted previously (), the mRNA levels were induced sharply after 30 min of stimulation. Although BCR induced much greater c- fos expression compared with P+I stimulation, the mRNA levels were sharply decreased and were undetectable beyond 2 h, whereas significant levels of mRNA persisted for 4 h upon P+I stimulation. Importantly, similar kinetics and expression patterns were observed in freshly isolated murine splenic B cells. Although BCR induced c- fos mRNA with essentially identical kinetics as observed with the B cell line, LPS, which stimulates via TLR4 ( Toll- like receptor- 4) (, ), induced c- fos mRNA production with a slightly delayed kinetics reminiscent of the P+I induction observed with the B cell line (see A). Overall, these data agree with previous reports (). Signal-induced Chromatin Changes The rapid kinetics of PRGs is explained partly by their constitutively open chromatin architecture (). Thus, PRGs show a high level of pre-existing H3K4me3 across the promoter region as well as H3K36me3 in the coding region. In addition, there is a dynamic turnover of histone acetylation by the action of histone acetyltransferases and histone deacetylases, which affects all K4me3-modified histone H3, which is also detectable in the absence of signaling (, ). Therefore, to further understand the signal-specific regulation of c- fos, we sought to analyze how the chromatin marks are altered upon induction of B cells with either P+I or BCR by employing ChIP assays. First, we looked at H3K4me3 throughout the gene ( A) with an H3K4me3-specific antibody. As noted previously (, ), significant levels of constitutive H3K4me3 were observed. However, signal-induced enhancement of H3K4me3 was observed upon both stimulations and in a time-dependent manner. In accordance with H3K4me3 being predominantly associated with promoter activation, the highest signal was observed around the promoter region spanning the transcription start site (TSS) and dropped precipitously farther downstream and was barely detectable at the 3′-end of the gene ( A). In addition to the H3K4me3 mark, significant levels of constitutive H3 acetylation (total) were also observed ( B), and the signals were sharply enhanced upon both stimulations. Once again, the H3 acetylation signals were reduced drastically at downstream regions (). In summary, although minor differences were noted, no dramatic chromatin changes were observed in c- fos upon P+I versus BCR stimulation. Analyses of chromatin marks and Pol II. BAL17 cells were induced with either P+I or BCR for the indicated times in minutes. The recruitment of H3K4me3 ( A) and total acetylated histone 3 ( H3Ac; B) was measured by ChIP. Immunoprecipitated DNA was analyzed with primers targeting various segments of c- fos as indicated (positions are relative to the TSS depicted in the schematic). The samples were analyzed in triplicate and are reported as the mean ± S.D. Of the percentage of input DNA. The data shown represent one of three comparable experiments. The levels of total Pol II ( C) and Pol II phosphorylated at Ser 5 of the C-terminal domain ( Ser5-P; D) were measured by ChIP following stimulation with either P+I or BCR for the indicated times in minutes. Immunoprecipitated DNA was analyzed with primers targeting various segments of c- fos as indicated (positions are relative to the TSS depicted in the schematic). The samples were analyzed in triplicate, and the resulting data are reported as the mean ± S.D. Of the percentage of input DNA. The data shown represent one of three comparable experiments. Recruitment of Pol II We subsequently analyzed the recruitment of Pol II at the c- fos gene upon P+I or BCR stimulation. Previous studies indicated that a transcriptional pausing/elongation block regulates many genes, including c- fos (). Collectively, these studies suggest that in the basal/uninduced state, Pol II is engaged at the promoter-proximal region of these genes, pausing at ∼40 nucleotides downstream of the TSS. Mitogenic signals remove the elongation block and induce an elongation-competent complex that completes elongation and gene expression (). In agreement with these observations, we noticed a significant level of total Pol II signal in the absence of any signaling ( C). As expected, Pol II recruitment at the promoter region spanning the TSS and the first exon was greatly enhanced upon both types of signaling, and a noticeable amount of Pol II persisted in this region even at 4 h post-stimulation when mRNA was undetectable (). This was most apparent upon BCR stimulation ( C, right panel). However, the Pol II density at downstream regions (particularly at exon 3, position 1694) was drastically reduced ( C). Therefore, significant levels of Pol II persisted around the c- fos promoter region well after mRNA expression was extinguished. Interestingly, there appeared to be a low but above background level of Pol II accumulation at the 3′-end of the gene in both cases. Because phosphorylation of the C-terminal domain of Pol II is associated with regulation of transcriptional initiation and elongation at many promoters (, ), we analyzed these events at the c- fos promoter ( D). As observed previously for other PRGs (, ), an increase in phospho-Ser 5 Pol II roughly paralleled the increase in total Pol II. Interestingly, significantly elevated signals were observed at 30 min for each of the exons tested ( D), although P+I induction in general exhibited a much higher phospho-Ser 5 Pol II signal compared with BCR induction. Therefore, active Pol II persists throughout the body of the c- fos gene, with the highest levels associated with the promoter region spanning the TSS. Phospho-Ser 2 Pol II levels were not found to be significantly different between uninduced and induced conditions (data not shown). Transcriptional Elongation at the c-fos Gene As noted previously, many of the PRGs are regulated at the level of transcriptional elongation (,, ). Given that we observed a significant level of Pol II persisting at the promoter, we tested whether the polymerases are associated with elongation factors. DSIF ( DRB sensitivity- inducing factor) exerts dual regulatory effects by stably interacting with Pol II and recruiting various other factors to the Pol II elongation complex (). DSIF is composed of Spt4 and Spt5 subunits, which were originally isolated in yeast by a genetic screen for regulators of transcription initiation sites (, ). Using an antibody against Spt5, we observed that it closely mirrored Pol II recruitment ( A), suggesting that the polymerase is perhaps elongation-competent. A notable difference was observed at the 3′-end with very little Spt5 recruitment. However, given that Pol II is usually associated with Spt5 (), the sensitivity of the anti-Spt5 antibody might not be high, and any signal at the 3′-end might be below the detection limit under our assay conditions. Once again, the highest recruitment of Spt5 was observed around the promoter region, and the general pattern of its recruitment in response to either signal was similar, with relatively minor differences ( A). Analyses of transcriptional elongation. BAL17 cells were induced with either P+I or BCR for the indicated times in minutes, and the status of elongating Pol II was evaluated by ChIP. The recruitment of Spt5, a component of the elongation factor DSIF ( A), and the levels of H3K36me3 ( B) were analyzed. Immunoprecipitated DNA was analyzed with primers targeting various segments of c- fos as indicated (positions are relative to the TSS depicted in the schematic). The samples were analyzed in triplicate, and the resulting data are reported as the mean ± S.D. Of the percentage of input DNA. The data shown represent one of three comparable experiments. Because H3K36me3 is proportional to transcriptional activity (), we also tested this particular histone mark in response to both P+I and BCR stimulation. Although P+I stimulation resulted in a marked increase in H3K36me3 in a time-dependent fashion across the entire gene, H3K36me3 levels due to BCR stimulation were much less pronounced ( B). However, for both stimuli, the levels of H3K36me3 remained high even after 4 h across the entire gene (compare with ), suggesting persistent transcriptional activity even after significant mRNA is undetectable. Analysis of Pre-RNA and Splicing Several recent reports suggest that histone modifications may have a role in the regulation of splicing by modulating either the recruitment of the spliceosome or the Pol II elongation rate (). Moreover, H3K36me3 affects alternative splicing decisions by modulating the recruitment of splicing regulators (, ). Thus, we analyzed the production of primary unspliced mRNA (pre-mRNA) across the c- fos gene in response to both stimulations. In agreement with our observation that H3K36me3 persisted across the entire gene ( B), significant levels of pre-mRNA were detected even at 4 h ( A), although the highest levels in both experiments were observed at the 30-min time point. Of note, we observed a precipitous drop in pre-mRNA at later time points across the gene in response to BCR compared with P+I stimulation (the -fold induction is reported here in log scale). Analyses of pre-mRNA and splicing. BAL17 cells were induced with either P+I or BCR for the indicated times in minutes. A, time-dependent production of long unspliced RNA was monitored by real-time PCR and is reported relative to β-actin ( ActB) expression (normalized to unstimulated cells). The data are reported with a logarithmic y axis. B, association of the RNA splicing factor U2AF65 with c- fos was monitored by ChIP for the indicated times in minutes. Immunoprecipitated DNA was analyzed with primers spanning each of the exon ( Ex)/intron ( In) borders across the length of the c- fos gene (the exon/intron positions are relative to the TSS depicted in the schematic). The results were analyzed in triplicate and are reported as the mean ± S.D. Of the percentage of input DNA. Data are representative of one of three comparable experiments. Pre-mRNA splicing can occur co-transcriptionally, suggesting that splicing and transcription are mechanistically coupled (, ). Pre-mRNA splicing is an essential step in the expression of intron-containing genes and requires the assembly and activity of a spliceosome (, ). Because U2AF65 is a component of the spliceosome, we tested the recruitment of U2AF65 across the c- fos gene in response to both signals. U2AF65 was found to be constitutively associated with the c- fos gene, and its recruitment was enhanced upon both types of signaling ( B). However, the increase in U2AF65 was most noticeable at later time points. As reported previously (), the promoter region and downstream regions through to the intron 2/exon 2 region showed maximum recruitment of U2AF65, whereas farther downstream regions showed substantially less U2AF65 following mRNA expression kinetics. Thus, it seems that a significant portion of apparently full-length pre-RNA escapes splicing and persists when the mRNA ceases to exist. Importantly, a very similar pattern of mRNA production was also observed in splenic B cells in response to LPS and BCR signaling ( A). Given that P+I represents an artificial stimulation, we instead used LPS in primary B cells as a proxy for innate immune signaling. Unfortunately, BAL17 cell lines do not appear to express TLR4, and thus, they did not respond to LPS (data not shown). Although the c- fos mRNA expression in these cells showed a sharp peak at ∼30 min, the pre-mRNA profile persisted for >2 h (, A and B). Next, we tested whether any other PRGs might behave in a similar fashion. Indeed, egr-2 exhibited a profile similar to c- fos: pre-mRNA expression was high even when mRNA production was severely reduced (, A and B). Importantly, not all PRGs are regulated similarly. Thus, in the case of c- myc, both mRNA and pre-mRNA expression appeared to follow similar patterns (, A and B). Analyses of c- fos mRNA and pre-mRNA in primary splenic B cells. Primary resting B cells were isolated using negative selection against the activation marker CD43 and induced with either 25 μg/ml LPS or 10 μg/ml BCR. Isolated total mRNA was analyzed by real-time PCR with primers specific for c- fos mRNA ( A) or pre-mRNA ( B). Β-Actin ( ActB) was used as a normalization control. Data were analyzed in triplicate and are expressed as the mean ± S.D. Of the ratio of fos to β-actin (normalized to unstimulated cells). The visualization of the c- fos data was with a logarithmic y axis. Ex, exon; In, intron. We analyzed the production of pre-mRNA by using primers specific for exon/intron junctions, which indicated that these are elongated transcripts and that the signals are not due to the production of short abortive transcripts. To further confirm our results, we also tested the effects of the splicing inhibitor meayamycin (, ) on both mRNA and pre-mRNA production. As expected, meayamycin drastically inhibited the production of spliced mRNA in response to both P+I and BCR, whereas it did not inhibit the production of unspliced pre-mRNA ( A). In fact, meayamycin enhanced production of pre-mRNA in both experiments. Finally, we evaluated these pre-mRNA transcripts in the presence of DRB, which is a nucleoside analog that inhibits Pol II transcription (). In the presence of DRB, synthesis of pre-mRNAs and mRNAs is strongly inhibited (). Consistent with these observations, mRNA and pre-mRNA production was significantly inhibited in the presence of DRB ( B). Interestingly, the production of mRNA was more dramatically reduced compared with that of pre-mRNA in the presence of the same concentration of DRB, indicating that a portion of the detectable pre-mRNA pool could perhaps represent short transcripts. Taken together, these results indicate that although the spliced c- fos mRNAs are produced following known kinetics and are rapidly extinguished between 30 and 60 min post-stimulation, production of unspliced transcripts continues long after this time point. Thus, the c- fos gene (and other PRGs, e.g. Egr-2) is persistently transcribed, and at least a significant portion of transcription of these genes might be uncoupled from splicing, a phenomenon recently observed by Smale and co-workers (). Analyses of mRNA versus pre-mRNA. A, to detect BAL17 c- fos pre-mRNA, primers spanning two different exon ( Ex)/intron ( In) junctions (exon 1/intron 1 and intron 3/exon 4) were employed, and the results are reported as relative cDNA. BAL17 cells were preincubated for 30 min with the splicing inhibitor meayamycin ( M30) at a concentration of 10 n m prior to induction with phorbol 12-myristate 13-acetate ( PMA30) or BCR for 30 min. Primers targeting c- fos mRNA were used to report total transcripts, whereas primers consisting of 5′ c- fos+1016 (exon 2) and 3′ c- fos+1694 (exon 3) were employed to monitor spliced c- fos pre-mRNA transcripts. Real-time PCR analysis was performed in triplicate, and the results were normalized to unstimulated cells. B, BAL17 cells were preincubated for 10 min with 100 μ m DRB, followed by induction with P+I for 30 min. Isolated total mRNA was analyzed in triplicate by real-time PCR with primers specific for c- fos mRNA. As both meayamycin and DRB treatment affected the levels of β-actin mRNA, data are expressed relative to the amount of starting cDNA in the real-time PCR by dividing the starting amount of DNA by the inverse log of the number of cycles required to reach threshold: ng of cDNA/(POWER(2, C t)). Data were normalized to unstimulated cells and expressed as the mean ± S.D. Of triplicate analyses. DISCUSSION Post-embryonic cells, in a non-proliferating quiescent state (G 0), require mitogenic signaling to drive them into cell cycle entry (G 1). A characteristic of G 0 cells stimulated with growth factors is the induction of PRGs that are often turned on within minutes after stimulation (). Because of such rapid kinetics of PRG induction, it has always been a challenge to interrogate the changes in the chromatin landscape of these genes in the absence and presence of signaling. Chen and Allfrey () were the first to provide a correlation between alterations in chromatin architecture, histone acetylation, and PRG (c- fos and c- myc) transcription. Since then, numerous studies have addressed specific chromatin changes in eukaryotic genes, including PRGs (). Although the mRNA-encoding PRGs usually constitute ∼1% of the total message in the growing cell, they are necessary to drive cells to re-enter the cell cycle (). However, given that many PRGs are proto-oncogenes, whose sustained expression can have profound effects on cellular growth, the regulation of PRG expression in response to inductive signals is very tightly regulated at multiple levels, including transcriptional initiation and elongation and co-transcriptional and post-transcriptional events (, ). C- fos is one such PRG whose rapid but transient expression is associated with cellular proliferation (, ). Stimulation of mature B cells with anti-Ig promotes transition from the resting G 0 state into the G 1 phase of the cell cycle and rapidly induces mRNA expression of a set of genes, including c- fos, egr-1, egr-2, c- myc, and junB (). Because induction of c- fos transcription is one of the early hallmarks of B cell activation, studying c- fos epigenetic and transcriptional regulation might provide mechanistic insights to early events during B cell activation (, ). Toward this goal, we undertook a detailed study of c- fos regulation in response to a strong but generic signal (P+I) as well as a weaker but highly B cell-specific signal (anti-Ig/BCR). Consistent with previous studies (), P+I stimulation led to the production of steady-state mRNA that persisted for up to 4 h, suggesting a more sustained response. In comparison, BCR produced a more robust signal but sharply defined mRNA peak at ∼30 min (), indicating a more transient signaling event. Although the precise mechanistic basis for this difference is unclear at present, it has been noted that different signals produce different extents of antisense transcription from the c- fos locus in murine B cells (). Because we measured only total steady-state RNA, whether our assay conditions also reflect such a difference or possible transcription originating from the 3′-end is unclear at present. The chromatin marks that we tested did not reveal any significant distinctions between the two signals. Consistent with previous studies, c- fos exhibited substantial pre-existing H3K4me3 as well as total acetylated histone 3 marks (, A and B). In both cases, the marks were higher around the promoter region spanning the TSS and significantly trailed off at the 3′-end. However, both marks were significantly higher in response to P+I than BCR, suggesting that P+I stimulation results in a more open chromatin structure. Similar to prolonged mRNA production, these marks also persisted longer with P+I stimulation than with BCR stimulation. Consistent with the mRNA production and activating histone marks, the total Pol II recruitment was slightly higher, especially around the promoter region, in response to P+I ( C). Although the recruitment of Pol II to the promoter region was substantially reduced in a time-dependent fashion in response to P+I, it remained high in response to BCR stimulation. Interestingly, despite the fact that the Pol II recruitment was reduced at downstream regions, it was still noticeable at the 3′-end particularly in response to P+I. This was most apparent when the Ser 5-phosphorylated form of Pol II was assayed ( D). In general, the Ser 5-phosphorylated form of Pol II exhibited much higher signal in response to P+I compared with BCR. It is known that phospho-Ser 5 Pol II levels remain high as Pol II transcribes the first few hundred nucleotides of genes but decline farther downstream (, ). As Pol II elongates farther downstream, the levels of phospho-Ser 5 Pol II drop, and phospho-Ser 2 Pol II levels increase. However, lower levels of phospho-Ser 5 Pol II do persist throughout elongation (). Consistent with an enhanced recruitment of Pol II at the 3′-end as well as persistent mRNA production in response to P+I, the phospho-Ser 5 Pol II levels also showed a spike at the 3′-end, indicating persistence of active Pol II at downstream regions. Given that the ChIP signals of acetylated histone 3 as well as Pol II and phospho-Ser 5 Pol II appear in general to be lower at exon 3 than at exon 4, there might be another transcript detected at exon 4 (such as an overlapping transcript). As a marker for transcriptional elongation, we analyzed recruitment of Spt5 as well as enrichment of the H3K36me3 histone mark. Not surprisingly, Spt5 recruitment in general tracked that of Pol II in response to both signals, although the total Spt5 recruitment was slightly higher in response to P+I, particularly at the 5′-end of the gene ( A). However, given that the ChIP signals were relatively low with anti-Spt5 antibody, we suspect that the sensitivity of this antibody is low and that any signal at the 3′-end is below the detection limit. Although H3K4me3 is high near promoters, H3K36me3 marks are high along transcribed regions (). Consistent with its association with transcribed regions, indicating elongating Pol II, H3K36me3 marks were higher at the downstream regions, especially in response to P+I ( B). Interestingly, the signals were higher at later time points at most regions tested in response to P+I. The H3K36me3 signals persisted throughout the transcribed regions in response to BCR and remained relatively unchanged ( B). Because these experiments indicated that transcriptional elongation persisted beyond 30 min time when the mRNA signal was highest, we tested whether long (and presumably full-length) pre-mRNA transcripts were being generated. Indeed, long pre-mRNA transcripts were detected in response to both signals ( A). Surprisingly, no pre-mRNA transcripts were detected in the absence of any signaling, although a noticeable amount of Pol II was associated with the c- fos gene under these conditions. Robust levels of pre-mRNAs were detected post-signaling at both the 5′- and 3′-ends up to 4 h in response to P+I. In contrast, BCR signaling generated pre-mRNAs primarily at 30 min, which coincided with mRNA production, although a low level was also detected at later time points. That c- fos pre-mRNAs are indeed produced in response to BCR stimulation at later time points is better illustrated when analyzed in primary splenic B cells ( B). In addition to c- fos, egr-2 pre-mRNA expression also persisted at later time points when the mRNA expression was severely reduced (, A and B). Although the c- fos kinetics was sharper compared with egr-2 (), this is not unexpected, given that c- fos is one of the most rapidly and tightly regulated genes. Moreover, the total levels of both mRNA and pre-mRNA were much higher for c- fos than observed for egr-2. Our preliminary RNA-Seq results performed under identical conditions also suggest that several PRGs are indeed regulated in a similar fashion (data not shown). We also showed that not all PRGs were regulated in a similar fashion, as exemplified by c- myc (). This is not totally unexpected given that c- myc plays a crucial role in B cells and that deregulation in myc is associated with lymphoid malignancies (). Nevertheless, although this regulatory step is not observed in all PRGs, it is clear that significant transcription continues for hours for some PRGs when mRNA production is sharply reduced. Because PRGs can be regulated at the level of splicing () and because pre-mRNA splicing can occur co-transcriptionally (), we tested the recruitment of the important spliceosome factor U2AF65 in response to both signals. Surprisingly, the recruitment of U2AF65 was not substantially enhanced after 30 min of stimulation with P+I but was enhanced in response to BCR ( B). Moreover, U2AF65 recruitment was observed at 4 h post-stimulation in response to both stimuli. However, recruitment of U2AF65 was substantially reduced almost to the background level at downstream regions. If U2AF65 recruitment is indicative of splicing activity, our results suggest that although a significant level of transcription persists after mRNA subsides (particularly in response to P+I stimulation), a proportion of these transcripts escape splicing. In a recent elegant study, Smale and co-workers () show by employing high-resolution deep sequencing that full-length yet incompletely spliced transcripts accumulate in macrophages in response to LPS stimulation, suggesting that splicing often occurs after transcription has been completed, with transcripts retained on the chromatin until fully spliced. Although we did not determine whether the pre-mRNAs we observed were indeed full-length, they were sensitive to DRB ( B), thereby indicating that they require elongating Pol II. Moreover, unlike mRNAs, pre-mRNAs were insensitive to the splicing inhibitor meayamycin ( A). Although the increase in pre-mRNA production in the presence of meayamycin could be directly at the expense of mRNA production, it remains to be proven. In summary, our results suggest that regulation of c- fos (and perhaps other PRGs) in B cells occurs at multiple levels, including transcription, splicing, and message stability. They also show that depending on the nature of the stimulus, the locus can remain more active (exhibiting activating histone marks as well as engaging elongating Pol II) well after the functional effects (in this case, mRNA production) of the stimulus are extinguished. Thus, the mitogenic stimulus appears to be stronger transcriptionally, but the maximum transcript levels are determined post-transcriptionally. So the fact that P+I produces more pre-mRNA at later time points might reflect that there is also detectable mRNA at these times. Hence, the mRNA levels are proportional to the amount of pre-mRNAs but only up to some maximum levels (threshold effects). Accordingly, it remains possible that a significant portion of the c- fos mRNA under our experimental conditions was produced concomitant with pre-mRNA but that they were rapidly degraded at later time points. All together, our results might explain the deleterious effects of mitogenic and/or tumor-promoting signals, which can lead to prolonged locus opening and aberrant transcription and splicing. In this regard, it is interesting to note that splicing factor mutations have recently been found in several hematological malignancies (). Future studies will indicate the precise regulatory steps and signaling intermediates involved in regulation of PRGs in response to antigenic and mitogenic signals in B cells. Footnotes • * This work was supported, in whole or in part, by National Institutes of Health Grant AI079206 (to A. This work was also supported by American Heart Association Grant 12GRNT12180023 (to A. • 2 The abbreviations used are: BCR B cell receptor PRG primary response gene P+I phorbol 12-myristate 13-acetate + ionomycin DRB 5,6-dichloro-1-β- d-ribofuranosyl-1 H-benzimidazole Pol II RNA polymerase II TSS transcription start site. • Received January 17, 2013. • Revision received March 19, 2013. • © 2013 by The American Society for Biochemistry and Molecular Biology, Inc. |
AuthorWrite something about yourself. No need to be fancy, just an overview. Archives
February 2018
Categories |